Molecular identification of virulence genes of Pseudomonas aeruginosa isolated from fish (Cyprinus carpio) in Mosul city | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Iraqi Journal of Veterinary Sciences | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Article 16, Volume 36, Issue 4, October 2022, Pages 953-958 PDF (702.46 K) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Document Type: Research Paper | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
DOI: 10.33899/ijvs.2022.132660.2119 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Authors | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Asmaa J. Altaee; Sumaya Y. Aldabbagh* | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Department of Microbiology, College of Veterinary Medicine, University of Mosul, Mosul, Iraq | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Abstract | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Depending on the nature of the fish's environment, they are susceptible to many pathogens, including bacterial causes, so the goals of the current study are isolation and molecular identification of Pseudomonas aeruginosa with its prevalence rate and detected virulence genes from fresh common carp fish. The swabs were taken from the gills, skin, intestine and muscles of 75 fish samples from variable localities from Mosul city during the period September to December in the year 2021. The prevalence percentage of bacteria was 26.66% which was confirmed by traditional microbiological tests which included (phenotype culture, microscopically features and API-test) and molecular identification. The isolates formed 42.5, 37.5, 15, 5% from gills, skin, intestine and muscles, respectively. The molecular results of forty isolates determine that Pseudomonas aeruginosa have rpoB 100%, and virulence genes oprL, toxA, and algD, which are express the outer membrane protein, exotoxin A and alginate respectively occur as 97.5% for the oprL gene and 100% of both toxA and algD genes. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Keywords | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cyprinus carpio; P. aeruginosa; Virulence genes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Full Text | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Introduction
Pseudomonas aeruginosa is considered one of the primary pathogens in fresh fish thus cause of high economic losses and high mortalities among fish (1). P. aeruginosa is a Gram-negative bacillus, motile by unipolar flagella. Aerobic bacteria catalase and oxidase positive, produce pyocyanin and pyoverdine pigments. It is firmly adaptable to many environments, including the aquatic environment (2). An opportunistic pathogen accountable for the severe death of fish and spoilage of fresh fish. P. aeruginosa it can cause severe lesions in fish, including, gill necrosis, hemorrhagic septicemia, congested kidney and friable liver especially when exposure to stress factors and changing in environmental condition as decreasing in O2 and variation in temperature (3). Moreover, P. aeruginosa can cause a problem for consumers associated with public health, some reports indicate that contaminated fish with enterotoxigenic Pseudomonas causes diarrhea and skin infection especially in the immunocompromised patient (4). The pathogenicity of Pseudomonas aeruginosa is related to its possession of many different virulence factors, some of them that related to the cell surface of bacteria that include; flagella, Pilli, lipopolysaccharide (LP), and alginate (algD), which contribute to the adhesion of bacteria in a host cell and colonization, as well as contribute in the transformation of active proteins. Therefore, cause recurrent infections (5). Others includes extracellular enzymes and toxins such as exotoxin S and exotoxin A, exotoxin A play a decisive role in inhibiting the protein biosynthesis process of host cell therefore, they aid for invasion and distribution of bacteria, thus accelerating of diseases progression (6). Toxin A is considered one of the influential virulence factors of this bacterium because it is accountable for inhibiting the protein biosynthesis in a host cell, which play a potent role in their pathogenicity. Toxin A encoded in the (toxA) gene is considered a prominent member of secretion system type II (T2SS) for P. aeruginosa (7). The invasion by this bacterium harboring this virulence factor leads to an increase in morbidity despite antibiotics use. The virulence mechanisms in P. aeruginosa varies depending on the infection environment (3). Many infections are caused by P. aeruginosa as a result of high resistance against antibiotics (8), which is due to the synergistic relationship between the effect of the low permeability of the cellular outer membrane and the existence of multidrug efflux pump in turn directly excludes antibiotics out of the cell (9). Lipoproteins play an important role in many processes necessary for bacterium cells, as adapting the bacteria to the environment and in bacterial infections outer membrane protein of this bacterium which contributes to resisting the antibiotics and disinfectant. Outer lipoprotein encoded in oprL gene (2) limited on Pseudomonads. Therefore, it could be a good maker that is used for detection of this bacterium in environmental and clinical samples and utilized as pathogenicity assessment for P. aeruginosa; therefor, recent studies used oprL gene for rapid detection of P. aeruginosa by PCR test (9,10). Alginate (Exopolysaccharide) is another virulence factor that protects the bacteria against antibiotics, disinfectants, and from the host's immune defense. Alginates contribute to bacterial adhesion to host cell (10), algD gene which encodes to (GDP-mannose dehydrogenase enzyme) that is formed the first unit in biosynthesis process of alginate (11). RNA polymerase Beta subunit which encoded in (rpoB) gene, was applied as a signature to diagnose this bacterium. Recent studies were focused on using rpoB genes for detecting P. aeruginosa due to high molecular identification ratio properties for the confirmation of the P. aeruginosa isolates. The researcher evaluated this bacterium that was isolated from fish by using the rpoB gene that gave 99.5% (5), also another study advises using the rpoB gene on the identification of this bacterium (10). Several studies revealed the virulence factors of Pseudomonas aeruginosa from a different source without paying attention to fish samples in Iraq. So, the goals of the current study are isolation and molecular identification of P. aeruginosa, and detected some genes encoding virulence factors from fresh fish (Cyprinus carpio) in Mosul city.
Material and methods
Fish samples A total of 75 samples of fresh fish (Cyprinus carpio) ranging between 100-350 g in weights were collected randomly from local markets of fish in Mosul city. For the period from September to December 2021, each sample was placed in a sterile plastic bag and transported directly to the microbiology laboratory under cooling conditions.
Bacteriological examination Swabs of skin and gills also one gram of intestine and muscle were taken aseptically and placed in tryptone soya broth then incubated at 25°C for 24 h. Then one loopfull from the cultivated TSB, was streaked on each tryptone soya agar, blood agar and MacConkey agar. The plates were incubated at 25°C for 24-48 h. The Suspected singles colonies were picked up and streaked on the cetrimide agar supplemented with nalidixic acid, and glycerol then incubated the plates at 25°C for 24-48 h (12). Phenotypic identification of isolates was done microscopically by Gram stain and biochemically by using oxidase, catalase, indole, methyl red, Voges-Proskauer, citrate utilization, and urease tests (13). All isolates were confirmed by using API E-test (BioMerieux). Then forty isolates were selected for molecular identification of Pseudomonas aeruginosa.
Extraction of DNA According to the manufactured company Pseudomonas aeruginosa isolates were subjected to genomic DNA extraction (Jena Bioscience, Germany). Fresh colonies of P. aeruginosa cultivated on BHIA for 24h were suspended in an Eppendorf tube for the Lysis of cells, followed by protein precipitation step. The supernatants were separated in a 1.5 ml Eppendorf microcentrifuge with 300 μl Isopropanol 99 %. Then the tubes were centrifuged and discarded the supernatant, then the draining tubes. Small pellets of DNA were washed using washing buffer by inverting it several times before being centrifuged. Then the supernatant was discarded, dried the tubes at room temperature, added 100 μl of Hydration solution for DNA hydration, and incubated it at 65 °C for one hour. The extracted DNA was stored under -20 °C for the following use (14,15).
Detection of Pseudomonas aeruginosa and their virulence genes by PCR reaction All forty samples were screened for P. aeruginosa using rpoB primers, rpoB- f (CAGTTCATGGACCAGAACAACCCG’) and rpoB- r(ACGCTGGTTGATGCAGGTGTTC’) synthesis in Macrogen, Korea. The program of amplification is described in (Table 1). The genes (oprL, toxA and algD) which are encoding for bacterial virulence factors are molecular identification depending on the primers in (Table 2). The PCR reaction mixture for all protocols was carried out according to the manufacturer's instructions. The master mix reaction was prepared by adding 12.5 µl of 2X Taq Premix (Ge-Net, Bio- Korea), 1 µl of each forward and reverse primers, 8 µl of PCR grade water, finally 2.5 µl of the DNA template. PCR cycling conditions were done in (Table 2) using a thermal cycler (Bio-Rad, T100, Bio-Rad - USA). Then the products of PCR were separated by 1.2% of agarose gel (Promega, USA), which contained Prime Safe Dye by (Ge-Net, Bio- Korea). Electrophoresis conditions of include (75 V- 300 mA -1h) using Wide Mini -Sub Cell GT (BioRad, USA). After that, the gel was observed using the (Gel-doc-Ez) system to revealing the specified bands (16,17).
Table 1: PCR setting program of amplification
Table 2: Features of primers and PCR setting program amplification
Results
Pseudomonas aeruginosa isolates appeared as Gram-negative rods, motile, catalase, and oxidase tests positive produced yellow green, pyoverdine and blue green exopigmentation, pyocyanin on cetrimide agar, lactose non fermented on MacConkey agar, beta hemolysis on blood agar. The isolates were confirmed using the API-E test. Through bacteriological tests for fish samples, we obtained 80 isolates of pseudomonas aeruginosa 42.5, 37.5, 15, 5% from the gills, skin, intestine, and muscles, respectively (Table 3). The amplification PCR products showed the target identified DNA fragment which indicating that the bacteria P. aeruginosa possess high DNA (Figure 1). All 40 isolates were analyzed and presented positive results rpoB gene (Figure 2). The PCR results for P. aeruginosa showed that, oprL, algD, and toxA virulence genes were detected in all forty strains 97.5% for oprL and 100% for the other two genes. The oprL gene was amplified in all positive isolates giving the product of 505 bp (Figure 3). algD and exoA genes were amplified in all isolates 100% giving a product of 1310 bp and 350 bp, respectively (Figures 4 and 5).
Table 3: The number and percentage of pseudomonas aeruginosa isolated from fresh fish
Figure 1: PCR final products of pseudomonas aeruginosa.
Figure 2: PCR final products for Pseudomonas aeruginosa using the rpoB gene. Well, M; DNA marker 100 bp. Well 1-11 positivefish samples giving 759 bp; well 12 negative control.
Figure 3: PCR products for the OprL gene. Lane M, standard DNA, well 2-5 and 7-10 positive P. aeruginosa fish samples giving 505 bp product size; well 1: negative control.
Figure 4: PCR products for the algD gene. Lane M, standard DNA; well 1-12 positive samples gave 1310 bp product size; well 13 negative control.
Figure 5: PCR products for toxA gene. Lane M, standard DNA; well 1-13 positive freshfish samples giving 354 bp product size.; well 14: negative control.
Discussion
In the current study we obtained eighty isolates of P. aeruginosa from the gills, skin, intestine and muscles specimens from the fish market. The highest percentage of isolation reached 42.5% from gills followed by skin 37.5%, then intestine formed 15%, finally isolates from muscles formed 5%. The prevalence rate of P. aeruginosa reached 26.6%. This result was close to Hana et al. (19) and Yaseen et al. (20) finding, who obtained 30, 22% and Abd El Tawab et al. (1) who obtained 16.7%, 25% from the skin and gills respectively, while higher than Sanhoury et al. (21) who isolated it at a percentage 10.5%. The variations in the ratio may be due to the host immunity, the number of bacteria, seasonal and environmental variation (21,22). These results indicated to the possibility of serious fish diseases such as septicemia when fish are under stressed or unsuitable environmental conditions. this is considered the main cause of economic losses and effects on public health due to eating, handling and transporting (4). The PCR results revealed that all P. aeruginosa harbored the rpoB gene. This result is consistent with the finding of Benie et al. (5) who indicated that 99.5% of his isolates were contained the rpoB gene. Therefore, it is advised to use the rpoB gene that gives reliable results because it has high molecular identification properties to confirm the P. aeruginosa, also Tayeb et al. (23) reported that using sequencing of rpoB as routine identification of Pseudomonas strains. The rpoB gene performance on identification of P. aeruginosa strains could be illustrated by the fact that the differentiation between the species so close to this bacterium was obtained by the molecular analyses of this gene (5). Also, Baskan et al. (10) indicate that the rpoB gene give more accurate results than the 16S rRNA gene therefor; the rpoB gene could be used in the detection of P. aeruginosa in contaminated food products (10). The study appeared that oprL genes were present in 97.5% of P. aeruginosa isolates that produce positive PCR amplicons products at 504 bp. These findings in consent with the findings each of Abd-El-Maogoud et al. (9), Algammal et al. (18), and Mehri et al. (24) who showed that all tested strains 100% harbored this gene. The oprL gene contributes significantly to the resistance of this bacterium to antibiotics and disinfectants, as it directly affects the efflux systems, which in turn affects the permeability of the cell membrane to antibiotics (3), as well as oprL could be a reliable factor for diagnosis of P. aeruginosa in environmental and clinical isolates (20). The study showed that all tested isolates contained algD genes. The results disagree with the studies of Benie et al. (5) (5) who recorded 77.5 and 54.5% from fresh and smoked fish respectively. The algD gene encodes for alginate production. Alginate is one of the essential virulence factors for this bacterium. It is an exopolysaccharide that represents the mucous layer and has a high viscosity, and provides protection for the bacteria cell from defensive factors of the host such as phagocytic cells (2), also participates in the formation of the biofilm and play a role in resistance to antibiotics (11). Also, this study showed that toxin A which encoded in the toxA gene were present 100% in all forty isolates, produced positive PCR amplicons products at 354 bp. This result is incompatible with Baskan et al. (10), andSiriken et al. (25) that all fish isolates harbored the toxA gene. The presence of this gene is associated with the pathogenicity of this bacterium, because it responsible for inhibiting the protein biosynthesis in the host cell. Thus, it facilitates the dissemination of bacteria through all tissue (2,7).
Conclusion
This study concludes that the rpoB gene is the identification gene for P. aeruginosa, which has variable virulence factors encoded by genes oprL, algD and ToxA responsible for antibiotic resistance, biofilm formation, and protein biosynthesis inhibition. Therefore, may be constitute serious diseases on common carp fish, thus consequently causing economic losses and affecting consumers' health.
Acknowledgments
We would like to thank the College of Veterinary Medicine- University of Mosul, Mosul, Iraq.
Conflict of interest
The authors declare that he has no conflict of interest. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
References | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Statistics Article View: 636 PDF Download: 408 |