Bas.J.Vet.Res.Vol.15,No.4,2016. ISI Impact Factor:3.461
92
DIRECT DETECTION OF STREPTOCOCCUS
ZOOEPIDEMICUS FROM ABORTED UTERUS OF
MARES BY USING PCR TECHNIQUE
Jaber Afat Alwan Al-Waily* ; Kadhim Hasan Abbas**;Ali Mohammed
Ghazi**
*Center of original Arabic horses , University of Al-Qadissyia, Al-Qadissyia,Iraq
**College of veterinary medicine, University of Al-Qadissyia, Al-Qadissyia,Iraq
(Received 11April 2016,Accepted 13December 2016)
Keywords: Metritis ,Mares, PCR techinque.
ABSTRACT
Streptococcus zooepidemicus is one of the the main causitive opportunistic
pathogen of the equine genital system and one of the secondary bacterial disease
that causes mucosal bacterial infections . In the present study, PCR technique
was used to detect S. zooepidemicus directly from uterine samples of infected
mares based on specific amplification superoxide dismutase (sodA) gene primers
that were designed by using the partial sequence of S.equi subsp. zooepidemicus
strain 65843 superoxide dismutase (sodA) gene, (GenBank: GU436869.1) and
primer3 plus for PCR primer design. The results showed high prevalence
detection of S. zooepidemicus (76%) positive uterine swab samples (38/50). This
study was concluded that S. zooepidemicus is the one of silant pathogen that
cause metritis in mares. PCR is very fast and specific tool used to detect of S.
zooepidemicus.
INTRODUCTION
Streptococcus equi subspecies zooepidemicus is Gram positive bacteria, round
cocci which are set as pairs or chains, facultative, anaerobic, catalase and oxidase
negative, nonmotile, hemolysis design depend on the species of streptococcus this
species ordered as mesophilic bacterial growth (1,2). Lancefield group C from
Bas.J.Vet.Res.Vol.15,No.4,2016. ISI Impact Factor:3.461
93
this bacteria reflected commensal and opportunistic pathogen of respiratory
disease in equine and also cause uterine infection(3). It can also cause several
diseases in a wide range of animal , human hoset(4,5). This bacteria differ from
S.. equi by some biochemical responses as lactose and sorbitol fermentation but
not trehalose fermentation(6). About 98% DNA series character with S. equi. it
shows as great antigens see L and see M have only been confirmed in particular
strains of S. zooepidemicus(7). Newly certain strain of S. zooepidemicus
exhibition recognized superantigens Szef,SzeN and Szep(8). Pathogenesis used
very inconstant M-like cell wall anchard surface protein Szep which found in all
strains of S. zooepiedmicus at least in horses where it fixes fibrinogen and
exhibites antiphagocytic action that damages host protection device(9). It can
spread from animal to human and cause diseases in human as periodic cases. The
main outbreak described qualified food-born bases of S. zooepidemicus after
feeding unpasteurized dairy yields and the symptoms described are meningitis,
Septicaemia, purulent arthritis, nephritis and endocarditis(10,11). In addition
Purpura hemorrhagica can be seen after infection with S. zooepidemicus in
horses(12). This bacteria is not hostly controlled nor restricted to the respiratory
system and wound or joint infections. The current study were aimed to detect S.
equi subspecies zooepidermicus in the uterus of local breed pregnant mares by
using PCR technique.
MATERIALS AND METHODES
Samples collection
Fifty uterine swab samples were collected from infected clinically horses with
endometritis after abortion in different local field in Al-Diwanyia province. The
samples were put in transport media and then sent to laboratory of Zoonotic
Diseases Unite in veterinary college of AL_Qadissyia university for bacterial
isolation.
Bas.J.Vet.Res.Vol.15,No.4,2016. ISI Impact Factor:3.461
94
DNA genomic extraction of Bacteria
DNA genomic of bacteria was extracted from 1ml of transport media swabs by
using (PrestoTM Mini gDNA Bacteria Kit, Geneaid. USA). Following the
manifactrer trainers. The removed gDNA was then tested by Nanodrop
spectrophotometer and then stored at 20 ᵒC untile use.
Polymerase Chain Reaction (PCR)
PCR technique was achieved to detect S. zooepidemicus by specific
magnification of superoxide dismutase (sodA) gene. These primes were intended
from NCBI-GenBank published sequence of S. equi subsp. zooepidemicus strain
65843 superoxide dismutase (sodA) gene, partial cds (Genbank: GU436869.1) and
primer3 plus design online. The primers were used to amplify 172bp fragment of
extremely conserved regions of sodA gene in S. zooepidemicus. sodA-Forward
primer (GCAGCAGCTATTGATGACGC) and sodA-Reverse primer
(GCTTGCCCTCTGAGATTGGT) were provided by (Bioneer company . Korea).
PCR master mix was prepared by using (AccuPower® PCR PreMix kit. Bioneer.
Korea). The PCR premix tube comprises freeze-dried pellet of (Taq DNA
polymerase 1U, dNTPs 250μM, Tris-HCl (pH 9.0) 10mM, KCl 30mM, MgCl2
1.5mM, stabilizer, and tracking dye). The PCR master mix response was equipped
conferring to kit instructions in 20μl total volume by adding 5μl of purified
genomic DNA and 1μl of 10pmole of forward primer and 1μl of 10pmole of
reverse primer. The PCR premix tube by deionizer PCR water into 20μl and briefly
mixed by Exispin vortex centrifuge (Bioneer. Korea). The reply was done in a
thermocycler (Mygene Bioneer. Korea) by set up the following thermocycler
conditions; initial denaturation at of 95 °C for 5 min; monitored by 30 cycles at
denaturation at 95 °C for 30 s, annealing at 60 °C for 30 s, and extension at 72 °C
for 30 s and then final extension at 72 °C for 5 min. The PCR yields were noticed
by electrophoresis in a 1.5% agarose gel, stained with ethidium bromide, and
visualized under UV transilluminator.
Bas.J.Vet.Res.Vol.15,No.4,2016. ISI Impact Factor:3.461
95
RESULT AND DICUSSION
soda gene was succeflty amplified by using PCR. Results showed 38 positive
samples out of 50 samples 78% of sodA gene . positive results showed clear and
sharp bands on agrose gel electrophoresis(figure 1).
Figure (1): PCR products of DNA amplicon visualized by Ethidum bromide
stained agrose gel electrophoresis are clearly detected Lane (M) represents
DNA marker (100bp) , Lane (1) represents positive control DNA St.
zooepidemicus isolate, and Lane (2-4) represents some positive samples at
172bp PCR product.
The PCR system has benefit to notice pathogen straight incompainion with
bacterial culture method. Furthermore PCR is more subtle and can be used to
notice together live and dead bacteria(13,14,15). In this study PCR was used for
identification of S. zooepidemicus based on amplification of specific superoxide
dismutase (sodA) gene, which is also used by Alber et.al. (16) who explained that
extension of the sodA and seeI or seeH genes is recycled for detect and variation
between S. equi, S. equi zooepidemicus and S. pyogenes. On other hand, Baverud
and et.al(17) advanced the real time PCR technique as more profound and
specific practice to magnify soda gene also in order to notice and distinguish of
Bas.J.Vet.Res.Vol.15,No.4,2016. ISI Impact Factor:3.461
96
Streptococcus spp. From the above , This study concluded that S. zooepidemicus is
the one of saliant pathogen that responsible for metritis in mares and PCR
technique is a very fast and specific technique to detect S. zooepidemicus.
Streptococcus zooepidemicus التحری المباشر عن جرثومة العقدیة السوافیة
من رحم الافراس باستخدام تقنیة تفاعل سلسلة البلمرة
جبار عفات علوان الوائلی،کاظم حسن عباس ،علی محمد غازی
مرکز بحوث الخیول ، جامعھ القادسیھ ،القادسیھ ،العراق
کلیة الطب البیطری ،جامعھ القادسیھ ،القادسیھ ،العراق
الخلاصة
لی از التناس یب الجھ ی تص ائعة الت ة الش ات الانتھازی ن الممرض دة م وافیة واح ة الس ة العقدی د جرثوم تع
اب ة (التھ یة المخاطی ات الاغش بب التھاب ی تس ة الت ة الثانوی راض الجرثومی ن الام د م ة وواح یلة الخیلی للفص
ورة ر خط ة الاکث یة الغازی الات المرض وین الح ی تک بب ف ن التس ؤولة ع ون مس ا تک رة) وربم ف والحنج الان
رض رة لغ لة البلم ل سلس کالالتھاب الرئوی والالتھاب الرئوی الجنبی .فی ھذه الدراسة تم استخدام تقنیة تفاع
ات ابة بالتھاب راس مص ة لاف ات رحمی ن عین ذت م ی اخ وافیة الت ة الس ة العقدی ن جرثوم ری ع ف والتح الکش
رحمیة وتقوم ھذه التقنیة على التضخیم النوعی لجین sodA ة ذه الدراس ب الذی صمم فی ھ تخدام التعاق باس
الجزئی لجین soda لعترة جرثومة العقدیة السوافیة 65843 (بنک الجینات GU ) أظھرت نتائج 436869.1
% دارھا 76 ابة مق بة اص 50 ) وبنس / ة ( 35 د الدراس ة قی ابة بالجرثوم بة الاص اع نس ة ارتف ة الحالی الدراس
ی ارزة الت یة الب ببات المرض ن المس دة م ی واح وافیة ھ ة الس ة العقدی ى ان جرثوم ة ال ائج الدراس ت نت وخلص
تسبب التھاب الرحم فی الافراس وان تقنیة تفاعل سلسلة البلمرة التی استخدمت فی التحری عن الجرثومة تعد
تقنیة سریعة ونوعیة فی الکشف والتشخیص
REFERENCES
1-Quinn P, Markey B, Leonard F, FitzPatrick E, Fanning S & Hartigan
P.(2011).Veterinary Microbiology and Microbial Disease. 2ed . Blackwell Science
Ltd.ISBN.978.
Bas.J.Vet.Res.Vol.15,No.4,2016. ISI Impact Factor:3.461
97
2-Hardie JM and Whiley RA.(1995).The genus streptococcus In: Wood , B.J et
al.,(Eds.).The Genera of Lactic Acid Bacteria.ed.pp:55-124.Glasgow,Uk:Blackie
Academic & professional .ISBN.
3-Newton JR, Wood JL, Dunn KA, DeBrauwere MN & Chanter N.(1997).
Naturally occurring persistent and asymptomatic infection of the guttural pouches
of horses with Streptococcus equi. Vet Rec 140, 84–90.
4-Bisgaard M, Bojesen AM, Petersen MR and Christensen H.(2012). A major
outbreak of streptococcus equi subsp.zooepidemicus infections in free-range
chickens is linked to horses . Avian Dis.56(3):561-566.
5-Eyre D, Kenkre J, Bowler I and McBride SJ.(2012). Streptococcus equi
subspecies zooepidermicus meningitis- acase report and review of the
literature.Eur.J.of Clin.Microb.29:1459-14616.
6-Spellerberg B and Brandt C.(2007) Streptococcus Manual of Clinical
Microbiology, 9th edn (Barron EJ & Murray PR, eds), pp. 412–427. ASM Press,
Washington, DC
7-Holden M, Heather Z, Paillot R, Steward K, Ainstie F, Bason N, Holroyed
N, Mungall K, Quail M, Sanders M Brooks K, Simmonds M, Anensen D,
Spratt B, Jolley K, Maiden M, Bentley S, Robinson C, Maskell D, Parkhill J
and Waller A. (2009).Genomic evidence for the evolution of streptococcus equi
: host restriction , increased virulence , and genetic exchange with human
pathogens.
8-Palliot R, Darby AC, Wright NL , Steward K, Webb K, Holder M,
Hughes MA, Radford A, Erles K and Waller AS.(2010). Identification of three
novel superantigen–encoding genes in Streptococcus equi subspecies
zooepidermicus. Infect. and Immune. 78:4817-4827.
9-Walker RL and Runyan CA.(2003).Identification of variation in Szp proteins
of streptococcus equi subspecies zooepidermicus and the relationship between
Bas.J.Vet.Res.Vol.15,No.4,2016. ISI Impact Factor:3.461
98
protein variants and clinical signs of infwction in horses.American J. of
vet.Res.64:976-981.
10-Bordes-Benitez A, Sanchez-Onoro M, Suarez-Bordon P, Garcia-Rojas A,
Alamo-Antunez I and Bolanos-Rivero M.(2006).Outbreak of Streptococcus equi
subspecies zooepidermicus infections on island of gran canaria associated with the
consumption of inadequately pasteurized cheese.Eur.J.of Clinical Micro. And
Infect. D. 25:242-246.
11-Kuusi M, Lathi E, Virolainen A, Hatakka M, Rantala L, Seuna E,
Kappelin M, Hakkinen M, Gindonis V and Huotari K.(2006).An outbreak of
streptococcus equi subspecies zooepidermicus associated with consumption of
fresh goat cheese.BMC infectious diseases 6,36.
12-Pusterla N, Watson J, Affolter V, Magdeian K, Wilson W and Carlon
G.(2003).Purpura haemorrhagica in 53 horses. Vet. Rec. 153:118-121.
13-Newton JR, Verheyen K, Talbot NC, Timoney JF, Wood JL, Lakhani
KH and Chanter N. (2000) Control of strangles outbreaks by isolation of
guttural pouch carriers identified using PCR and culture of Streptococcus equi.
Equine. Vet. J. 32, 515-526.
14-Gronbaek LM, Angen O, Vigre H. and Olsen, SN. (2006) Evaluation of a
nested PCR test and bacterial culture of swabs from the nasal passages and from
abscesses in relation to diagnosis of Streptococcus equi infection (strangles).
Equine Vet. J. 38, 59-63.
15-Timoney JF. and Artiushin SC. (1997) Detection of Streptococcus equi in
equine nasal swabs and washes by DNA amplification. Vet. Rec. 141,446-447.
16-Alber JA, El-Sayed S, Estoepangestie C, Lammler and Zschock
M.(2005). Dissemination of the superantigen encoding genes seeL, seeM, szeL and
szeM in Streptococcus equi subsp. equi and Streptococcus equi subsp.
zooepidemicus. Vet. Microbiol. 109:135-141.
Bas.J.Vet.Res.Vol.15,No.4,2016. ISI Impact Factor:3.461
99
17-Baverud V, Johansson SK and Aspan A.(2007). Real-time PCR for
detection and differentiation of Streptococcus equi subsp. equi and Streptococcus
equi subsp. zooepidemicus. Veterinary microbiology 124(3-4), 219-29.
