Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
806
MOLECULAR DETECTION OF METHICILLIN-RESISTANT
Staphylococcus aureus
ISOLATED FROM MILK AND CHEESE OF COW AND BUFFALOES
IN BASRAH CITY
Weam Abd Ali Aboud and Bassam Yasein Khudaier*
Department of Microbiology, College of Veterinary Medicine, University of Basrah,
Basrah, Iraq.
Keywords: Staphylococcus aureus, Milk, Cheese, Buffaloes.
Corresponding: Bassamy10@yahoo.com
ABSTRACT
In the present study, 135 samples were collected from different animal's including:
75 samples were from milk and 60 samples were from cheese, 54 (40%) sample were found
to be harbored with Staphylococcus aureus. The rate of S. aureus isolates was 50% in
buffalo's cheese, 40.54% in buffalo's milk, 36.8% in cow's milk, and 33.33% in cow's
cheese. 100% strains were Methicillin Resistance Staphylococcus aureus. The antibiotic
sensitivity test was determined against 8 common antibiotics by the agar disc diffusion
method on Muller-Hinton agar. These antibiotics were amoxicillin (25mcg), ampicillin
(10mcg), Oxacillin (1mcg), chloramphenicol (30mcg), erythromycin (15mcg), gentamycin
(10mcg), methicillin (5mcg), and tetracycline (30mcg). S. aureus strains were screened by
PCR for 16S rRNA and nuc genes. 49 out of 54 S. aureus isolates were yielded products
with molecular weight approximately (228 bp) corresponding to 16S rRNA gene, 42 out of
54 isolates were give products with molecular weight approximately (270bp) corresponding
to nuc gene, 22 and 4 out of 30 S. aureus isolates were give products with molecular weight
approximately (310bp and 509bp) corresponding to mecA and femA genes, respectively.
INTRODUCTION
The genus Staphylococcus includes over 30 species and subspecies, the most important
species for the human and veterinary medicine is S. aureus which is among the most frequent
causal organisms in human and animal's bacterial infections. S. aureus is one of the leading causes
Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
807
of foodborne disease outbreaks due to its ability to produce staphylococcal enterotoxins [1,2].
Antibiotics Methicillin resistant Staphylococcus aureus (MRSA) is important because, in addition
to being methicillin resistant, most strains are also resistant to other β-lactam antibiotic, with the
exception of glycopeptide [3].The genus Staphylococcus is Gram-positive bacteria, and particularly
S. aureus is one of the most harmful species of staphylococci encountered. It is extremely a major
important pathogens, and it’s one of the most common causes of nosocomial infections, especially
pneumonia, surgical site infections and blood stream infections, it’s also the leading cause of
bacteremia, myocarditis, acute endocarditis, pericarditis, osteomyelitis, encephalitis, meningitis,
chorioamnionitis, mastitis in dairy animals, and scalded skin syndrome and continues to be a major
cause of community-acquired infections [4].
More recently, Methicillin Resistance Staphylococcus aureus (MRSA) has been
isolated from most animals and foods of animal origin. MRSA strains have been isolated from
cows’ or small ruminants’ milk and various dairy products in many countries. The MRSA
prevalence in milk and dairy products reported from different countries or even regions of the
same country differs significantly [5,6,7,8,9].Depending on growth conditions, the colony
pigmentation varies from grey, grey white with yellowish to orange shades and a typical β-
haemolysis on the blood agar [10]. The methicillin resistance mechanism is well understood in
MRSA strains [11]. It is caused by the production of a novel penicillin-binding protein, PBP-2a,
with a decreased binding affinity for β-lactams [12]. This process is encoded by the chromosomal
gene mecA that is found in the mec region. The sequence of mecA gene is conserved in all
methicillin-resistant strains of S. aureus [13].The β-lactam antibiotics damage bacteria by
inactivating penicillin-binding proteins that are essential in the assembly of the bacterial cell wall
[14]. The aim of this study is to evaluation of the occurrence of S. aureus in milk, and cheese
from cows and buffalos in Basrah city, antimicrobial-resistance pattern, and detection of the
important genes 16S rRNA and nuc genes (S. aureus species specific determinants), and mecA
and femA genes (methicillin resistance determinant).
MATERIALS AND METHODS
Collection of Samples and Identification of S. aureus:
A total of 135 samples were collected; included 75 samples of raw milk: 38 cows’
milk samples and 37 buffalo’s milk samples, and 60 samples of cheese: 30 samples were
from each of cows’ cheese and buffalo’s cheese). Samples were collected during the period
from October 2017 to February 2018 from different area of Basrah City. All samples were
Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
808
transported in an ice box to laboratory of microbiology. Milk samples were immediately
cultured onto mannitol salt agar (MSA), and incubated at 37oC for 24-48 h. Mannitol
fermenting colonies (i.e. those that were yellow or gold) were selected from the MSA and
sub-cultured on Blood agar (BA. The colonies were subjected to Gram’s staining, catalase
test, coagulase test, oxidase test, and DNase test. [15]. Cheese samples were processed
depending on [16].
Antimicrobial Susceptibility Testing
Antimicrobial susceptibility test for isolated S. aureus were determined by the agar
disk diffusion method [17].in Mueller-Hinton agar (MHA) plate. The turbidity of the actively
growing broth culture was adjusted to the 0.5 McFarland standard [18].
Antimicrobial susceptibility performed for 8 common antibiotics, amoxicillin
(25mcg), ampicillin (10 mcg), Oxacillin (1mcg), chloramphenicol, (30mcg), erythromycin
(15mcg), gentamicin (10mcg), methecillin (5mcg), and tetracycline (30mcg). The results
were recorded after 24h incubation at 35oC according to the guidelines of the National
Committee of Clinical Laboratory Standards guidelines [18].
DNA Extraction and PCR Assay
DNA template was extracted using the presto Mini g DNA Bacteria Kit
(Geneaid/korea). A PCR reaction with specific primers was performed to identify (16S rRNA),
nuc, mecA, and femA in each isolate. A total PCR reaction mixture was 25μl contained: 12.5μl
Green Go Taq Master Mix pH 8 (Promega, USA) contained [(50unit/ml) of Go Taq DNA
polymerase, (400Mm) of each dNTPs and (3mM) of MgCl2], 1 μl for each primers, 5μl
DNA template and the mixture was complete to 25μl by adding 5.5μl deionized distilled water.
The oligonucleotide primers that used for generated bands for the genes detection are illustrated
in the table (1) and reaction to each PCR reaction was listed in table 2.
Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
809
Table 1: The oligonucleotide primer sets used for the genes.
Gene Primer Sequences
Product
size (bp)
Sources
16SrRNA
F;GTAGGTGGCAAGCGT TATCC
R:CGCACATCAGCGTCAG
(228) [20]
Nuc
F:GCGATTGATGGTGATACGGTT
R:AGCCAAGCCTTGACGAACTAAAGC
(270) [20]
mecA
F:GTAGAAATGACTGAACGTCCGATGA
R:CCAATTCCACATTGTTTCGGTCTAA
(310) [21]
femA
F:AGACAAATAGGAGTAATGAT
R:AAATCTAACACTGAGTGATA
(509) [19]
Table 2: Primer conditions sets used for the genes.
Primer The condition
16SrRNA
Initial denaturation 94oC for 2min, 35 cycle (94oC for 30 sec, 50oC for 30 sec,
72oC for 45 sec) and final extension 72oC for 4 min.
Nuc
Initial denaturation 95oC for 2min, 35 cycle (94oC for1min, 50oC for 50sec,
72oC for 2min) and final extension 72oC for 5min.
mecA
Initial denaturation 95oC for 4min, 30 cycle (94oC for 30sec, 53oC for 45sec,
72oC for 4min) and final extension 72oC for 4 min.
femA
Initial denaturation 94oC for 5min, 30 cycle (94oC for 30sec, 45oC for 1 min,
72oC for 45sec) and final extension 72oC for 10 min.
Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
810
RESULTS
Isolation and Identification
In the present study, 135 samples were tested (cows’ milk, buffalo’s milk, cows’
cheese and buffalo’s cheese). These samples Included 75 milk’s samples and 60 cheese’s
samples. S. aureus isolated from 54 samples (40%). The highest rate of S. aureus
isolation was observed in buffalo’s cheese 15/30 (50%), followed by buffalo’s milk 15/37
(40.54%), then cows’ milk 14/38 (36.8%), and cows’ cheese 10/30 (33.33%). Table (3).
Table 3: prevalence of Staphylococcus aureus isolated from milk and cheese
Sample source of animal No. of sample No. of S. aureus (%)
Cows’ milk 38 14 (36.8)
Buffalo’s milk 37 15 (40.54)
Cows’ cheese 30 10 (33.33)
buffalo’s cheese 30 15 (50)
Total 135 54
p>0.05 no significant
Screening for Methicillin Resistance S. aureus (MRSA)
By using agar disc diffusion method, 30 randomly selected S. aureus isolates
were subjected for susceptibility toward methicillin. Total of the 30 (100%) S. aureus
strains were MRSA which were isolated in this study.
Antimicrobial Susceptibility
Table (4) provides antimicrobial susceptibility results by agar disc diffusion test.
Interestingly, 30 S. aureus isolates exhibited the Multi-Drug Resistance (MDR) trait
against 8 commonly used antibiotics; the isolates were completely resistant (100%) for
amoxicillin, ampicillin, Oxacillin , and methicillin, and (92%) of them were sensitive to
chloramphenicol and gentamycin and (8%) resistant, while all the tested isolates were
completely sensitive to tetracycline (100%), and (72. %) sensitive for erythromycin and
26% resistant (2% intermediate) p> 0.05, Figure (1).
Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
811
Figure 1: Disc diffusion method with inhibition zones for antibiotics against S. aureus.
Table 4: Antimicrobial Susceptibility pattern of MRSA isolated from milk and dairy
products.
Sensitive
(%)
Intermediate
(%)
Resistance
(%)
Concentration
(mcg)
Antibiotic
Amoxillin (25) 100 - -
Ampicillin (10) (100) - -
Oxacillin (1) (100) - -
(30) - (8) (92)
Chloramphenic
ol
Erythromycin (15) (26) (2) (72)
Gentamycin (10) (8) - (92)
Methicillin (5) (100) - -
Tetracycline (30) - - (100)
Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
812
Detection of the 16S rRNA, nuc, mecA and femA Genes by PCR Assay
Results of PCR assay revealed that 49 (90.7%) isolates from total 54 isolated
S.aureus were yielded products with molecular weight approximately (228 bp)
corresponding to 16S rRNA gene, as showed in Figure (2), 42 isolates of them (54 isolates)
were gave products with molecular weight approximately (270bp) corresponding to nuc
gene, Figure (3).
While 22 out of 30 S. aureus isolates were gave products with molecular weight
approximately (310 bp) corresponding to mecA gene, Figure (4), and only 4 out of 30 S.
aureus isolates were yielded products with molecular weight approximately (509 bp)
corresponding to femA gene p> 0.05, Figure (5).
Figure 2: Agarose gel electrophoresis of PCR-amplified for 16S rRNA gene and nuc
gene of S. aureus isolates. LineM: DNA marker. Lines. 1-3: nuc gene 270bp and 1-4
16s rRNA gene 228bp and line C: Negative control.
M 1 2 3 C M 1 2 3 4 C
500
200
Nuc gene 270bp 16s rRNA gene 228bp
Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
Figure 4: Agarose gel electrophoresis of PCR
isolates. Line. M: DNA marker. Line
Figure 5: Agarose gel electrophoresis of PCR
isolates. Line. M: DNA marker
control.
500
M 1 2 3 4 5 6 7 8 9
1200
500
200
M 1
500
813
PCR-amplified for mecA
: Lines. 1-9: mecA gene 310 bp; Line.
PCR-amplified femA gene of
marker. Lines. 1-5: femA gene 509bp
fem A gene 509 bp
femA gene 509
2 3 4 5
MecA gene 310 bp
gene of S. aureus
C: Negative control.
S. aureus
line C: Negative
C
C
Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
814
DISCUSSION
The results of bacterial isolation and identification from milk and cheese of cows
and buffaloes revealed that 54 out of 135 (40%) samples were implicated with S. aureus.
Among 135 samples, 75 milk's samples showed (40.54%) buffalo milk and (36.8%) cow
milk, and 60 cheese samples showed (50%) buffalo cheese and (33.33%) cow cheese.
The percentage of S. aureus infection in the present study agreed with the study
conducted in Iraq [5]. The present study results are in line with study of [22].who
reported that the percentage of S. aureus was (48.57%) from bovine’s milk. But it's not in
agreement with the results that recorded by [6, 23].which were (10.23%) and (21.25%),
respectively. Several studies have demonstrated that pathogenic bacteria like S. aureus
may responsible for vomiting, abdominal cramps and diarrhea like diseases in humans
[24,25,26,27,28]
Thirty S. aureus isolates were subjected towards different antibiotics. The
percentage of susceptibility toward methicillin and oxacillin was (100%). The present
study is along with the study of Nusrat [23].who found that coagulase positive S. aureus
was found to be highly resistant against oxacillin (100%). In addition to that occurrence
of methicillin resistant S. aureus in food samples has been a major concern worldwide
[29].In developing countries more than 70% of infecting bacteria have been accounted as
multi drug resistant strain (MDR) [30,31].noticed the least effective drugs were
tetracycline, and amoxicillin with bacterial resistance percentages of 65.2%, and 55.6%,
respectively.
S. aureus isolates were analyzed by PCR assay. DNA from S. aureus isolates of
milk and cheese were extracted by purification kit to detect the presence of 16S rRNA,
nuc, mecA, and femA genes. In the present study, 90.7 % S. aureus isolates that identified
were confirmed by amplification of the 16S rRNA gene [32] confirmed that 100% of S.
aureus isolates from cow and buffaloes were produced 16S rRNA gene. The present
study agreed with the study of Al-Ashmawy [31] found that all recovered S. aureus
isolates were genetically verified as MRSA strains by molecular detection of the mecA
gene.
Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
815
CONCLUSION
The high percentage of methicillin resistant S. aureus isolates which also resistant
to the most of the antibiotics used, which may be milk and milk products the main source
of transmission to humans and these are a high risk to human health.
الکشف الجزیئی للمکورات العنقودیھ المقاومھ للمثیسیلین المعزولھ من الحلیب والاجبان للابقار
والجاموس فی مدینة البصره
وئام عبد علی عبود ،بسام یاسین خضیر
فرع الاحیاء المجھریھ، کلیة الطب البیطری ، جامعة البصره ، البصره ، العراق
الخلاصة
فی ھذه الدراسة، تم جمع ١٣٥ عینة من الحیوانات المختلفة بما فی ذلک: ٧٥ عینة من الحلیب و ٦٠ عینة
حیث کان معدل S.aureus . من الجبن، ووجد أن ٥٤ عینة ( ٤٠ ٪ ) تحتوی على المکورات العنقودیة الذھبیة
عزلات المکورات العنقودیة 50 ٪ فی جبن الجاموس ، و ٤٠.٥٤ ٪ فی حلیب الجاموس ، و ٣٦.٨ ٪ فی حلیب البقر
، و ٣٣.٣٣ ٪ فی جبن البقر. اظھرت جمیع عزلات المکورات العنقودیة الذھبیة ١٠٠ ٪ مقاومة للمضاد الحیوی
المیثیسیلین. تم تحدید اختبار الحساسیة للمضادات الحیویة تجاه ثمانیة انواع من المضادات الحیویة الشائعة من خلال
على وسط مولر-ھینتون اکار. ھذه المضادات الحیویة ھی agar disc diffusion method طریقة
،(30mcg) 30 )، کلورامفینیکول mcg) 10 )، أمبیسیلین / کلوکساسیللین mcg) 25 )، أمبیسیلین mcg) أموکسیسیلین
30 ). وبعدھا تم فحص mcg) 5)، وتتراسیکلین mcg) 10 )، میثیسیلین mcg) 15 )، جنتامیسین mcg) إریثرومایسین
nuc 16 و S rRNA لجینات PCR سلالات المکورات العنقودیة الذھبیة بواسطة تقنیة التفاعل التسلسلی للبلمرة ال
. تم الحصول على ٤٩ عزلة من أصل ٥٤ عزلة من المکورات العنقودیة الذھبیة کانت ذات وزن جزیئی ٢٢٨ قاعدة
نایتوجینیة تقریبًا ،تعبر عن جین الحامض النووی الریبی النووی 16 ،بینما أعطت ٤٢ من اصل ٥٤ عزلة حزم ذات
فی حین اعطت ٢٢ و ٤ من ٣٠ عزلة من المکورات ، nuc وزن جزیئی ٢٧٠ قاعدة نایتوجینیة تقریبًا تعبر عن جین
و ٥٠٩ قاعدة نایتوجینیة تقریبًا ای تحمل mecA gene العنقودیة الذھبیة حزم ذات اوزان جزیئیة ٣١٠ ای تحمل
femAgene.
Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
816
REFERENCES
1-Hennekinne, JA.De Buyser, ML. and Dragacci, S. (2012). Staphylococcus aureus
and Its Food Poisoning Toxins: Characterization and Outbreak Investigation. FEMS
Microbiol. Rev. 36(4): 815–836.
2- Tenhagen, BA. Vossenkuhl, B. Käsbohrer, A. Alt, K. Kraushaar, B. Guerra, B.
Schroeter, and Fetsch, A.(2014).Methicillin-Resistant Staphylococcus aureus in cattle
food chains - prevalence, diversity, and antimicrobial resistance in germany. J. Anim.
Sci. 92: 2741-51.
3-Chambers, HF. (1997). Methicillin resistance in Staphylococci: molecular and
biochemical basis and clinical implications.Clin. Microbiol. Rev. 10: 781-791
4- Kumar, R. Yadav, BR. and Singh, RS. (2010). Genetic determinants of antibiotic
resistance in Staphylococcus aureus isolates from milk of mastitis crossbred cattle. Curr.
Microbiol. 60(5): 379-386.
5- Khudaier, BY. Abbas, BA. And Khudaier, AM. (2013). Detection of methicillin
resistant Staphylococcus aureus isolated from human and animals in Basrah Province /
Iraq. MRVSA 2(3): 12-21.
6-Khudaier, BY. Anad, IT. and Abbas, BA. (2014). Isolation of Staphylococcus
aureus from Buffalo milk in Basra Governorate and Detection of their Antibiotic
Susceptibility. Bas. J. Vet. Res. 13(1): 1-12.
7-Pexara, A., N. Solomakos, and A. Govaris. (2013). Prevalence of Methicillin
Resistant Staphylococcus aureus in Milk and Dairy Products. J. Hellenic Vet. Med. Soc.
64 (1): 17-34.
8- Khaleel, DA. Uthman, RM. and Khudaier, BY. (2016). Isolation and
Identification of Staphylococcus aureus from Buffaloes Milk Infected with Subclinical
Mastitis and Milk Workers. Bas. J. Vet. Res. 16(2): 304-312.
Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
817
9- Abbas, BA. Khudaier, BY.and Khudaier, AM. (2017). Studies on mecA gene in
methicillin resistant Staphylococcus aureus isolates. Jokull. 67(6): 58-65.
10-Medveďová, Alžbeta, and Ľubomír Valík. (2012). Staphylococcus aureus:
Characterisation and Quantitative Growth Description in Milk and Artisanal Raw Milk
Cheese Production. In Tech. 32: 71-102
11-Lowy, FD. (2003). Antimicrobial Resistance: The Example of Staphylococcus
aureus. J. Clin. Invest. 111(9): 1265-1273.
12-Hartman, BJ. and Tomasz, A. (1984). Low-Affinity Penicillin- Binding Protein
Associated with R-Lactam Resistance in Staphylococcus aureus. J. Bacteriol. 158 (2):
513-516.
13- Weller, Timothy MA. (1999). The Distribution of mecA, mecR1 and mecI and
Sequence Analysis of mecI and the Mec Promoter Region in Staphylococci Expressing
Resistance to Methicillin. J. of Antimicrobl. Chemother. 43: 15-22.
14- Pinho, Mariana G., Hermínia de Lencastre, and Alexander Tomasz(2001).
Acquired and a Native Penicillin-Binding Protein Cooperate in Building the Cell Wall of
Drug-Resistant Staphylococci. PNAS. 98 (19): 10886-10891
15-Macfaddin, JF. (2000). Biochemical tests for identification of medical bacteria. 3rd
Ed. Lippincott Williams and Wilkins USA.
16- -Jaber N.N.(2011).Isolation and boityping of staphylococcus aureus from white
cheese in Basrah local markets. Bas.J.Vet.Res.Vol.10, No.2
17- Kirby, WM. and Bauer, AW. (1966). Antibiotic susceptibility testing by a
standardized single disc method. Amer. J. Clin. Path. 45: 493-496.
18-National Committee on Clinical Laboratory Standards (NCCLS), (2003).
Performance standards for antimicrobial susceptibility tests. Approved standard. NCCLS
document M2-A8. National committee on clinical laboratory Standards, Wayne, P.A.
19- Chikkala, R., George, N. O., Ratnakar, K. S., Iyer, R. N., & Sritharan, V. (2012).
Heterogeneity in femA in the Indian isolates of Staphylococcus aureus limits its
usefulness as a species specific marker. Advances in Infectious Diseases, 2(03), 82.
Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
818
20- KarmakarA, DuaP, and Ghosh C, 2016. Biochemical and Molecular Analysis of
Staphylococcus aureus Clinical Isolates from Hospitalized Patients, Hindawi Publishing
Corporation Canadian Journal of Infectious Diseases and Medical Microbiology Article ID
9041636, 7 pages.
21- Othman H.E, Merza,N.S, and Salih Jubrae J.M .(2014). Nucleotide sequence
analysis of methecilin resistant staphylococcus aureus in kurdistan region –Iraq, Journal
of University of Zakho, Vol. 2(A), No.1, Pp 65-73,
22- Hanon, BM. (2009). Comparative study to the Staphylococcus aureus, isolated from
the bovine and human with detection of virulence (coa) gene in these isolates by
polymerase chain reaction. M.Sc. Thesis, College of Veterinary Medicine, University of
Basrah.
23-Nusrat J., Ifra, TN. and Mrityunjoy, A. (2015). Detection of methicillin-resistant
Staphylococcus aureus within raw milk and cheese samples. Inter. Food Res. J. 22(6):
2629-2633.
24- Aly, SA.and Galal, EA. (2002). Effect of milk pretreatment on the keeping quality
of Domiati cheese. Pakistan J. Nutr. 1: 132-136.
25- Robinson, RK. (2002).The microbiology of milk and milk products. In Dairy
Microbiology Hand Book, p. 765. New York: John Wiley and Sons.
26- Soomro, AH. Arain, MA. Khaskheli, M. and Bhutto, B. (2003). Isolation of
Staphylococcus aureus from milk products sold at sweet meat shops of Hyderabad.
Online J. Biological Sci. 3(1): 91-94.
27- Chye, FY. Abdullah, A. and Ayob, MK. (2004). Bacteriological quality and safety
of raw milk in Malaysia. Food Microbiol. 21: 535-541.
28-Marjan, S. Das, KK. Munshi, SK. and Noor, R. (2014). Drug-resistant bacterial
pathogens in milk and some milk products. Nutr. Food Sci. 44(3): 241-248.
29- Shanehbandi, D., Baradaran, B., Sadigh-Eteghad, S. and Zarredar, H. (2014).
Occurrence of methicillin resistant and enterotoxigenic Staphylococcus aureus in
traditional cheeses in the north west of Iran. ISRN Microbiology.
http://dx.doi.org/10.1155/2014/129580
Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
819
30- Prescott, JF. (2000). Antimicrobial drug resistance and its epidemiology. In Prescott,
JF. Baggot, JD. and Walker, RD. (Eds.). Antimicrobial Therapy in Veterinary Medicine,
P. 27-49. Ames: Lowa State University Press, Ames.
31- Al-Shmawy, M. Sallam, KI. And Elhadidy. (2016). Prevalence, Molecular
Characterization, and Antimicrobial Susceptibility of Methicillin-Resistant
Staphylococcus aureus (MRSA) Isolated from Milk and Dairy Products. Foodborne
Pathogens Dis. 13(3). 1-7.
32- Elsayed, MS. El-Bagoury, AM.and Dawoud, MA. (2015). Phenotypic and
genotypic detection of virulence factors of Staphylococcus aureus isolated from clinical
and subclinical mastitis in cattle and water buffaloes from different farms of Sadat City in
Egypt. Vet. World. 8: 1051-1
