Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
491
SEROLOGICAL AND MOLECULAR DETECTION OF
TOXOPLASMA GONDII IN MEAT AND MINCED MEAT IN
BASRA CITY
Battol Ali Majeed* Wamedh Hashim Abbas**
*College of Veterinary Medicine,University of Basrah,Basrah,Iraq
**Al-Zahraa medical College , University of Basrah,Basrah,Iraq
Key words: Toxoplasma gondii, ELISA, PCR, B1gene.
Corresponding author: ta646094.ba@gmail.com
ABSTRACT
The present study was conducted during the period between September 2017
and March 2018 to detect Toxoplasma gondii in meat. A total number of 387 blood,
meat and minced meat were collected from cattle, sheep, goat and buffalo carcasses at
slaughter house and butcher markets in Basra city. Molecular and serological methods
were applied to detect the infection of T. gondii by using PCR and ELISA tests for all
these samples. The results of ELISA showed that 25.32% of samples were positive,
while 15.762% were positive for PCR test. Sheep showed the highest positive results
for ELISA and PCR tests (33.036%, 22.321% respectively) flowed by goat (29.333%,
18.667%), cattle (25.439%,14.912%) and buffalo (11.628%, 4.651%) respectively.
Positive ELISA and PCR results for minced meat (37.113%, 25.773% respectively)
were higher than meat from both butcher markets (27.778%, 18.519%) and
slaughterhouse (17.582%, 9.89%) respectively, while the results of ELISA and PCR
conducted for blood analysis were 17.582% and 6.593% respectively. Higher
toxoplasmosis ratio (32.195%, 21.951%) for ELISA and PCR respectively for
samples collected from butcher markets in the present study.
INTRODUCTION
Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
492
Toxoplasmosis is wide spread zoonotic disease caused by Toxoplasma gondii,
the ubiquitous coccidian parasite of felines, man and many domestic warm-blooded
animals (1). Infection of animals and humans with Toxoplasma gondii cause
abortion, stillbirth and neonatal death (2,3).
The meat from infected animals is one of the most important potential source
of human toxoplasmosis (4,5). Transmission of Toxoplasmosis to humans can occur
by humans eat raw or inadequately cooked infected meat or eat uncooked foods (6).
Diagnosis is usually made by immunological testing and molecular techniques
or by a combination of these techniques (7). Serological- tests such as ELISA that
include indirect ELISA test which can define as a simple, rapid and accurate method
for demonstration of IgM or IgG (8,9).
More specific, sensitive and reproducible detection of toxoplasmosis is
improve the molecular diagnosis of the protozoan infection by polymerase chain
reaction that used primers targeting B1 gene (10,11).
The Present study was aimed to evaluate two methods, ELISA and PCR to
detect the overall prevalence of T. gondii infection in animals (sheep, goat, cattle and
buffalo) from slaughterhouse and butcher markets.
MATERIALS AND METHODS
Sample collection
A total number of 387 blood, meat and minced meat samples were collected
between September 2017 and March 2018 from cattle, sheep, goat and buffalo
carcasses at slaughterhouse in Basra city (blood samples were collected before
slaughtering and meat samples were collected after slaughtering from the same
animal) and butcher markets in Basra city as describe in table 1.
Sera were obtained from blood samples by centrifugation and frozen
immediately at -20 ̊C. 387 samples were tested molecularly to detect T. gondii tissue
cyst (12).
Meat samples were minced thoroughly in sterile mincer. Meat and minced
meat samples were allocated into sterile containers (20 ml) and frozen for 60 days at -
Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
493
20 ̊C. The frozen samples were thawed overnight at room temperature, and meat juice
samples collected from the plastic bags. Meat juice and serum samples were
submitted for serological analysis immediately after thawing (13).
Table (1) Blood, meat and minced meat samples collection
Sample
Cattle Sheep Goat Buffalo
Slaughter Total
house
Butcher
markets
Slaughter
house
Butcher
markets
Slaughter
house
Butcher
markets
Slaughter
house
Butcher
markets
Blood 28 0 25 0 18 0 20 0 91
Meat 28 31 25 33 18 22 20 22 199
Minced
meat
0 27 0 29 0 17 0 24 97
Total 56 58 50 62 36 39 40 46 387
Detection of anti-T. gondii specific IgG
Detection of anti-T. gondii IgG antibody in meat, minced meat and sera
samples were performed by using ID screen® toxoplasma indirect multi-species
ELISA kit (ID. vet® France) according the leaflet of manufacture (14).
Molecular Detection of T. gondii
DNA extraction
The extraction of the DNA was done by using extraction kit (g SYNC tm DNA
Extraction kit Quick protocol manufactured by Geneaid, UK) according to
manufacture protocol.
PCR
The genomic DNA was subjected to PCR for amplifying B1 gene to detected
Toxoplasma gondii. The primers sequence were listed in Table (2) and final product
was 133 bp (15).
Table (2) The sequences of the primers used in the test
Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
494
NO. Target Primer sequence (5' 3') MT ̊ C
Pro. Size
Base pair
1.
B1gene
Forward
TTG CAT AGG TTG CAG TCA CT 56.5 C
133
2.
B1gene
Reverse
TCT TTA AAG CGT TCG TGG TC 55.5 C
The amplification reaction mixture (final volume, 25 μl) was carried out with
thermal cycler (Techne, UK). The program of amplification reaction consisted of one
denaturation step followed by 40 cycles and final elongation step described in table
(3).
Amplification products were visualized in a 1.5% agarose (15), using gel
electrophoresis stained with ethidium bromide. A Ladder 100 bp DNA was used as a
size marker in the gels.
Table (3) PCR program.
No Steps Temperature Time Cycles
I Initial Denaturation 94 ᵒC 2 min 1
II
Denaturation 94 ᵒC 30 sec
35
Annealing 55 ᵒC 30 sec
Extension 72 ᵒC 45 sec
III Final Extension 72 ᵒC 5 min 1
Statistical analysis
The results of present study were analyzed by SPSS program (version)
software 2010, using Chi-square test and P values of p < 0.05 were considered to
record statistical significance.
Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
495
RESULTS
A- ELISA results
1- Result of ELISA According to animal's type
According to animals type of 387 sample of different animals, to detect
Toxoplasma gondii ELISA results showed significant differences (panimals in presence of toxoplasma gondii IgG show in table (4). Sheep samples
showed the highest positive results (33.036%) followed by goat and cattle (29.333%,
25.439% respectively), while the lowest positive results were showed in buffalo
samples (11.628%).
Table (4) Distribution of T. gondii based on ELISA positive results in animals
according to the type of animals.
Animals
ELISA Result
Total
Negative Positive (%)
Cattle 85 29 (25.439%) 114
Sheep 75 37 (33.036%) 112
Goat 53 22 (29.333%) 75
Buffalo 76 10 (11.628%) 86
Total 289 98 (25.323%) 387
Chi square 13.970 df = 3 p<0.05
2-Result of ELISA According to samples type
The result of ELISA method made according to samples type of 387 different
animals, the results showed significant differences (pminced meat as presented in table (5).
The highest positive ELISA results were showed in minced meat samples (37.113%),
followed by meat samples collected from butcher markets (27.778%). while the blood
and meat samples collected from slaughterhouse showed the same results (17.582%)
which represent the lowest positive result.
Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
496
Table (5) Distribution of T. gondii IgG results in animals according to the type of
samples.
Sample ELISA Result
Total
Negative Positive (%)
Blood 75 16 (17.582%) 91
Meat after slaughtering 75 16 (17.582%) 91
Meat from butcher markets 78 30 (27.778%) 108
Minced Meat 61 36 (37.113%) 97
Total 289 98 (25.323%) 387
Chi square 13.136 df = 3 p<0.05
3-Result of ELISA According to site.
Recent results indicated that there were significant differences in seropositivity
against T. gondii among the studied animals at different site in Basra city (p<0.05)-
(Table 6). The highest positive results were detected in butcher markets (32.195%)
while samples from slaughterhouse gave the lowest positive results (17.582%).
Table (6) The distribution of T .gondii seropositivity in animals of different regions of
Basra city detected by ELISA.
B- PCR Results
Toxoplasma gondii B1 replicon (133 bp) was detected in blood, meat and
minced meat samples collected at slaughterhouse and butcher markets from different
animals through PCR protocol (Figure1).
Site ELISA Result
Total
Negative Positive (%)
Slaughterhouse 150 32 (17.582%) 182
Butchers Markets 139 66 (32.195%) 205
Total 289 98 (25.323%) 387
Chi square 10.127 df = 1 p<0.05
Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
497
Figure 1 Agarose gel electrophoresis for Toxoplasma gondii B1 replicon Lane
(2,3,4,5,6,7,8 and 10) represent the positive results while lane 9 negative, lane 1
indicates the Ladder 100 bp DNA marker.
1-Result of PCR According to animal's type
significant differences (p>0.05) in Toxoplasma gondii gene presence in
different animals under study were detected through PCR protocol that applying to
387 of different animals type (Table7)
Sheep samples showed the highest PCR positive results (22.321%) followed by goat
and cattle (18.667%, 14.912% respectively), while the lowest positive results were
showed in buffalo samples (4.651%).
Table (7) Distribution of T. gondii according to the type of animals.
Animal PCR Result
Total
Negative Positive (%)
Cattle 97 17 (14.912)% 114
Sheep 87 25 (22.321%) 112
Goat 61 14 (18.667%) 75
Buffalo 82 4 (4.651%) 86
Total 327 60 (15.762%) 387
Chi square 14.345 df = 3 p<0.05
2- Result of PCR According to samples type.
According to samples type of 387 different animals, the PCR results showed
significant differences (p<0.05) - between different samples (Table 8).
Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
498
The lowest positive PCR results were showed in blood samples (6.593%)
while the highest positive result were founded in minced meat samples (25.773%)
fallowed by Meat from butcher markets and from slaughterhouse (18.519%, 9.89%
respectively).
Table (8) Distribution of T. gondii according to the type of samples.
Sample PCR Result
Total
Negative Positive (%)
Blood 85 6 (6.593%) 91
Meat after slaughtering 82 9 (9.89%) 91
Meat from butcher markets 88 20 (18.519%) 108
Minced Meat 72 25 (25.773%) 97
Total 327 60 (15.762%) 387
Chi square 16.706 df =3 p<0.05
3- Result of PCR According to site.
There were significant differences in PCR results of T. gondii among the
studied animals of different site in Basra city to detect T. gondii (p<0.05) that shown
in table (9).
The highest positive results were detected in butcher markets (21.951%) while
samples from slaughterhouse gives the lowest positive results (8.242%).
Table (9) The Distribution of T.gondii B1gene in animals from different regions of
Basra city.
Site PCR Result
Total
Negative Positive (%)
Slaughterhouse 167 15 (8.242%) 182
Butchers Markets 160 45 (21.951%) 205
Total 327 60 (15.762%) 387
Chi square 12.805 df =1 p<0.05
Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
499
Comparison of ELISA and PCR results
As a results of all data presented earlier there were significant differences
(p<0.05) between ELISA and PCR results to detect T. gondii among the studied
animals (Table 10).
The total positive results of ELISA test of T. gondii (25.323%) were higher
than positive results of PCR test (15.762%) of overall sample tested.
Table (10) The comparison between ELISA and PCR protocols in detection of T.
gondii.
Test
PCR Results
Total
Negative Positive (%)
ELISA Results
Negative 289 0 289
Positive (%) 38 60 98 (25.323%)
Total 327 60 (15.762%) 387
Chi square 204.757 df =1 p<0.05
DISCUSSION
Toxoplasma gondii is widely prevalent and one of the most widespread
zoonosis in warm-blooded animals worldwide. T. gondii infection is widespread in
some of the most consumed food containing meat, especially make from sheep, goat,
cattle, buffalo, chicken, camel and pig. Eating undercooked or raw meat of animals
and eating food or drinking water contaminated with oocysts are the important source
of infection to human (16). The highest positive results for detection of T. gondii by
ELISA and PCR in sheep samples in comparison with goat and cattle samples were in
line with (5,17,16,18)who found that T. gondii is more frequently and consistently
detected in sheep in comparison with goat and cow. The explanation of these
differences may be refer to the geographical area, type of grassing and distribution of
final host (cats), in addition to the natural susceptibility to infection of sheep by T.
gondii. This in accordance with (19)who referred to that Goats are consuming the tops
of grass and small trees which may have lower T. gondii contamination levels
compared to sheep that are consuming the lower parts of the plants that T. gondii sero
prevalence was reported to be higher level. About susceptibility (20) found that sheep
were susceptible more 6 times than cattle.
Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
500
However, Raw or undercooked goat meat identified as potential sources for T.
gondii infection (21).
Result of ELISA and PCR According to animal's type
There were significant differences (p< 0.05) among animals type (Tables 4, 7).
The positive of ELISA and PCR results in sheep samples (33.036%, 22.321%
respectively) were the highest in comparison with goat (29.333%, 18.667%) and cattle
(25.439%,14.912%) respectively. This finding were in line with (5,17,16,18)who
found that T. gondii is more frequently and consistently detected in sheep in
comparison with goat and cow.
Raw or undercooked goat meat identified as potential sources for T. gondii
infection (21). Goats are susceptible to T. gondii infection, with reported
seroprevalence of T. gondii infection in goats ranging from 3.7% (22) to 81.8% (23).
T. gondii seroprevalence is generally lower in goats than sheep. The tops of grass and
small trees are more consumed by goats which may have lower T. gondii
contamination levels compared to sheep consumed the lower parts of the plants that T.
gondii seroprevalence was reported to be higher level ( 19).
The explanation of these differences may be refer to the geographical area,
type of grassing and distribution of final host (cats), in addition to the natural
susceptibility to infection of sheep which is likely infected by T. gondii 6 times more
than cattle (20).
On the other hand, the lowest result of buffaloes (11.628%, 4.651%
respectively) may be due to buffaloes are considered resistant to toxoplasmosis and
tissue cysts are reported to be found rarely in skeletal muscles of buffaloes (11).
Result of ELISA and PCR According to samples type
At recent research minced meat samples showed significant highest positive
results for both ELISA and PCR method in comparison with meat from both butcher
markets and slaughterhouse . The explanation of these finding may be due to the
contamination of meat during grounding with other infected remaining meat at a
contaminated mincer or equipment or due to mixing meat pieces from different
carcasses at butcher markets.
Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
501
These findings were in line with (24)who reported that ground meat
considered as one of the main foodborne risk factor for the recent T. gondii infection
in United States.
On the other hand the positive ELISA results of sera samples obtained from
animals before slaughtering gave the same results of meat samples obtained
from the same animal after slaughtering, giving an idea that ELISA test can be
used either in sera samples or from meat samples after slaughtering to detect
T. gondii antibodies in eating animals. While the lowest positive PCR results
were showed in blood samples which may explained by T.gondii is located
predominantly in the central nervous system, as well as skeletal and cardiac
muscle also in consistent with the other studies, Toxoplasma infection in
various tissues (25)
Result of ELISA and PCR According to site
According to site that samples collect from, ELISA and PCR results in butcher
markets in this study showed higher toxoplasmosis ratio compared with results from
samples collected at slaughterhouse and this may due to the absence of monitoring in
butcher markets compared with slaughterhouse. Regional variations may have been
attributed to climate cultural (26).
Comparison between total results of ELISA and PCR
It is evident at present study that T. gondii B1 gene (133 base pair) was
detected in blood, meat and minced meat samples collected at slaughterhouse and
butcher markets from different animals by using primers pair
5'TTGCATAGGTTGCAGTCACT3' as foreword primer and
5'TCTTTAAAGCGTTCGTGGTC3' as reverse primer. According to table 10 the total
98 ELISA positive samples include 60 PCR positive samples. On the other hand there
were no positive PCR samples in the 289 ELISA negative samples revealing that there
where high correlation between ELISA and PCR results. While the lower significant
(p< 0.05) positivity rate of PCR (15.762%) compared with the ELISA (25.323%) may
due to the low concentration of cysts in the tissues and random distribution (one cyst
per 50 – 100 g ) of tissue and by the small size of samples (27).
Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
502
Recommendations
1- Annual investigation of toxoplasmosis in domesticated animals including sheep,
goats, cattle and buffalo.
2- The animals, meat and minced meat should be submitted for periodic investigation
before and after slaughtering for detection of T. gondii as they might be toxoplasmosis
carriers and hazardous for animals and human.
3- The slaughtering of animals should be done in slaughterhouses under veterinarian
supervision.
4- Further studies should be done to investigate the prevalence of toxoplasmosis in
imported meat and meat derivatives.
REFERENCES
1-Bowman, D.D., Hendrix, C.M., Lindsay, D.S. and Barr, S.C., (2008). Feline
Clinical Parasitology. John Wiley and Sons, Chichester, UK.
2- Bossi, P. and Bricaire, F., (2004). Severe acute disseminated toxoplasmosis.
Lancet, 364(9434): 579.
3-Al-Kappany, Y. Abbas, I., Devleesschauwer, B., Dorny, P., Jennes, M. and
Cox, E., (2018). Seroprevalence of anti-Toxoplasma gondii antibodies in Egyptian
sheep and goats. BMC Vet Res. 2;14(1):120.
4- Innes, A.E., Bartley, P.M., Maley, S., Katzer, F., Buxton, D., (2009). Veterinary
vaccines against Toxoplasma gondii. Available at memorias.ioc.fiocruz.br.
5- Dubey, J.P., (2009a). Toxoplasmosis of Animals and Humans. 2nd ed. CRC Press,
Boca Raton, FL, USA.
6-Lopez, A., Dietz, V. J., Wilson, M., Navin, T. R., and Jones, J. L., (2000).
Preventing congenital toxoplasmosis. MMWR Recomm Rep, 49(RR-2), 59-68.
Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
503
7- Sukthana, Y., 2006. Toxoplasmosis: beyond animals to humans. Trends Parasitol,
22(3), 137-142.
8- Jabbar M, (2014). An Investigation of Toxoplasmosis in Women and Ewes by
Different Serological Assays in Maysan Governorate, Iraq.
9- Wallander, C., (2016). Toxoplasma gondii in wild boars and domestic pigs in
Sweden. Doctoral Thesis. Swedish University of Agricultural Sciences Uppsala.
10- Alves, M., O. Matos, and F. Antunes, (2003). Microsatellite analysis of
Cryptosporidium hominis and C. parvum in Portugal: A preliminary study. J.
Eukaryot. Microbial. 50 Suppl:529–530.
11- Gencay, Y., Yildiz,K., Gokpinar, S. and Leblebicier, A., 2013. A potential
infection source for humans: Frozen buffalo meat can harbor tissue cysts of
Toxoplasma gondii. Food control, 30, (1), 86–89.
12- Khlaty and A᾿aiz, (2014). Molecular and serological detection of Toxoplasma.
gondii in sheep in Wasit province. AL-Qadisiya Journal of Vet. Med. Sci. Vol. 14,
No. 2.
13- Račka, k., Bártová, E., Budíková, M. and Vodrážka, P., (2015). Survey of
Toxoplasma gondii antibodies in meat juice of wild boar (Sus scrofa) in several
districts of the Czech Republic. Annals of Agricultural and Environmental Medicine
2015, 22, 2, 231–235.
14- Mangili, P.M., Vesco, G., Feliziani, F., Paoloni, A., Menichelli, M., Cagiola,
M., Marini, C., Pourquier, P., Papa, P., (2009). Development and evaluation of the
performance of an in-house ELISA to be used for the indirect diagnosis of
Toxoplasmosis in sheep. Poster presented at the SIDILV meeting in Parma, Italy.
15- Al-Sanjary, R. and Hussein, T., (2012). Using species-specific PCR technique
to detect Toxoplasma gondii in broiler chickens. Iraqi Journal of Veterinary Sciences,
26, (2), (53-56).
16- Tonouhewa, A., B., Yao Akpo, Sessou, P., Adoligbe, C., Yessinou, E.,
Hounmanou, Y., G., Assogba, M., N., Youssao, I. and Farougou, S., (2017).
Toxoplasma gondii infection in meat animals from Africa: Systematic review and
meta-analysis of sero-epidemiological studies. Veterinary World, 10(2): 194-208.
Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
504
17- Asgari, Q., Kalantari, M., Motazedian, M. and Shahriari, B., (2010).
Molecular survey of Toxoplasma infection in sheep and goat from Fars province,
Southern Iran. Trop Anim Health Prod :DOI 10.1007/s11250-010-9704-1.
18- Sharif, M., Sarvi, S., Shokri, A., Hosseini Teshnizi, S., Rahimi, M.T., Mizani,
A., Ahmadpour, E. and Daryani, A., (2015). Toxoplasma gondii infection among
sheep and goats in Iran: a systematic review and meta-analysis. Parasitol. Res., 114,
1–16.
19- Jittapalapong, S., A. Sangvaranond, N. Pinyopanuwat, W. Chimnoi, W.
Khachaeram, S. Koizumi, and S. Maruyama. (2005). Seroprevalence of
Toxoplasma gondii infection in domestic goats in Satun Province, Thailand.
Vet.Parasitol. 127: 17-22.
20-Azizi, H., Shiran, B., Boroujeni, A. and Jafari, M., 2014. Molecular Survey of
Toxoplasma gondii in Sheep, Cattle and Meat Products in Chaharmahal va Bakhtiari
Province, Southwest of Iran. Iranian J Parasitol: 9, (3)429-434.
21- Guo, M., Mishra, A., Buchanan, R.L., Dubey, J., P., Hill, D., E. and Gamble,
H., R., (2016). A systematic meta-analysis of Toxoplasma gondii prevalence in food
animals in the United States. Foodborne Pathog. Dis., 13(3): 109-118.
22- Dubey, J. P., and D. S. Adams. (1990). Prevalence of Toxoplasma gondii
antibodies in dairy goats from 1982 to 1984. J.Am.Vet.Med.Assoc. 196: 295-296.
23- Costa, D. G. C., M. F. V. Marvulo, J. S. A. Silva, S. C. Santana, F. J. R.
Magalhães, C. D. F. Lima Filho, V. O. Ribeiro, L. C. Alves, R. A. Mota, J. P.
Dubey, and J. C. R. Silva. (2012). Seroprevalence of Toxoplasma gondii in domestic
and wild animals from the Fernando de Noronha, Brazil. J.Parasitol. 98: 679-680.
24- Jones, JL, Dargelas, V, Roberts, J, Press, C, Remington, J, S, Montoya, JG
(2009). Risk factors for Toxoplasma gondii infection in the United States. Clin Infect
Dis; 49:878–84.
25- Mendez, O. and Koshy, A., (2017). Toxoplasma gondii: Entry, association, and
physiological influence on the central nervous system. Available at
https://doi.org/10.1371/journal.ppat.1006351.
26-Bashir, A., Attie, O., Sullivan, M., Sebra, R., Singh, K., Altman, D., Pak, T.,
Dutta, J., Chacko, K., Webster, E., Lewis, M., Hamula, C., Carpini, K., Murray,
Basrah Journal of Veterinary Research,Vol.17, No.3,2018
Proceeding of 6th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
505
B., Kasarskis, A., Bakel, H., Huprikar, S. (2017). Genomic confirmation of
vancomycin-resistant Enterococcus transmission from deceased donor to liver
transplant recipient. PLoS One. 2017;12(3):e0170449. doi:
10.1371/journal.pone.0170449.
27-European food safety authority EFSA (2013): Scientific Opinion on the public
health hazards to be covered by inspection of meat from sheep and goats. EFSA
Journal 11: 3265 p
