MOLECULAR IDENTIFICATION OF (EfaA) IN ENTEROCOCCUS FECALIS AND ENTEROCOCCUS FACIUM AND THEIR ROLE IN BIOFILM FORMATION

Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
400
MOLECULAR IDENTIFICATION OF (EfaA)
IN ENTEROCOCCUS FECALIS AND ENTEROCOCCUS
FACIUM AND THEIR ROLE IN BIOFILM FORMATION
Ashwak B.J.Al-Hashimy, Aya H. Alhalaby
Genetic Engineering and Biotechnology Institute for Postgraduate Studies, Bagdad
University,Baghdad ,Iraq
Keywords: Enterococcus, EfaA genes, (PCR)
ABSTRACT
Total of (104) urine samples were collected from patients suffering from urinary
tract infection with different age groups from five hospitals in Baghdad (Ibn-
Albalady, Al Yarmouk, Medical city, Baghdad hospital and Al-Kandy) from the
period of the beginning of September 2015 to the end of December 2015.All samples
were examined by traditional methods based on cultural characteristics, biochemical
test and API 20 strep. The results revealed 50 isolates to Enterococcus and this was
confirmed by polymerase chain reaction technique (PCR) based on amplification of
species specific genes. PCR were performed for E.faecalis and E.faecium in order to
confirm the presence of EfaA genes which code for Enterococcus faecalis
endocarditis antigen using specific primer for gene.The results showed that
Enterococcus contain a proportion of 100% of EfaA.Biofilm production was detected
in E.faecalis and E.faecium by using two methods: Congo red agar method and
microtiter plate method.Our results show that22(44%) of Enterococcus isolates were
strong biofilm production,25(50%)as moderate and 3(6%) as week biofilm production
by use Congo red method.In microtiter plate method, our results show that 20(40%) of
bacterial isolates were detected as strong, 26(52%) as moderate and 4(8%) as week
biofilm production. This study aims todiagnosis of E.faecalis and E.faecium from
urinary tract infection of patients by traditional and molecular methods, detection of
EfaA gene and its role in biofilm production.
INTRODUCTION
Biofilm formation is a dynamic process involving the attachment of bacteria to a
biotic or abiotic surface and encased in a hydrated matrix of exopolymeric substances,
proteins, polysaccharides and nucleic acids (1, 2). Biofilms are notoriously difficult to
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
401
eradicate and are a source of many chronic infections, approximate 80% of microbial
infections occurring in the human body are biofilm-mediated (3).
More than 30 species in the genus Enterococcus have been described to date; the two
species Enterococcus faecalis and Enterococcus faecium, have gained significance as
leading opportunistic pathogens causing nosocomial infections (4, 5).Some
researchers reported that Enterococcus have become increasingly important as
nosocomial pathogens and have been found to form biofilms on several medical
devices implanted in patients, such as central venous catheters, urinary catheters,
intrauterine devices, and prosthetic heart valves (6,7).
Several Enterococcus pathogenic factors have been identified including adhesions and
secreted virulence factors (8). One of important virulence gene was E.faecalis antigen
A (EfaA)which was presumed to be involved in the adhesion of Enterococcus to biotic
and abiotic surfaces or evasion of the immune response (9). Some research report that
Enterococcus isolates with Asa1 and EfaA genes produced more biofilms than
negative ones and it seems that these genes have the highest contribution in biofilm
formation in the urinary tract isolates (10).In additionEfaA has been shown to have an
important role in pathogenesis of Enterococcus in infective endocarditis (11,12).
MATERIALS AND METHODS
*Clinical Isolates:-
Total of (104) urine samples were collected from patients suffering from urinary tract
infection with different age groups from five hospitals in Baghdad (Ibn- Albalady, Al
Yarmouk, Medical city, Baghdad hospital and Al-Kandy) from the period of the
beginning of September 2015 to the end of December 2015.
* Isolation and identification of Enterococcus by traditional methods:-
-Culturing on selective media:-
The isolates were identified by characteristic colony morphology of Enterococcus on
selective media (bile esculin agar) which gave round shape colony with slightly
convex smooth edges, creamy color and convert media into black.
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
402
* Molecular identification of Enterococcus:-
-Bacterial Genomic DNA Extraction:-
Genomic DNA was extracted from the bacterial isolates using Presto Mini g DNA
bacteria Kits (Geneaid, Thailand), fallowing the company instructions.
*Detection of Enterococcus by molecular method:-
-Detection of Enterococcus speciesby using species specific primer:-
Multiplex PCR used for conformation identification of the E.faecalis and E.faecium,
reactionwas conducted in 20 μl of reaction mixture containing 13μl of distilled water,
PCR master mix (Bioneer Corporation), 1μl forward from each genes and 1μl reverse
primer from each genes (table-1)and 3 μl of DNA (table-2).
Table (1): The Sequence of forward and reverse primers used in this study
Genes Sequence (5' to 3') Size Reference
ddlE.
Faecium
F:TTGAGGCAGACCAGATTGACG
R:TATGACAGCGACTCCGATTCC
658 13
ddl E.faecalis F:ATCAAGTACAGTTAGTCTTTATTAG
R:ACGATTCAAAGCTAACTGAATCAGT
941 13
Table (2):The Mixture of multiplex PCR working solution for the detection of
Enterococcus species
Component Volume (μl)
Primer F. 2
Primer R. 2
DNA 3
water 13
Total Volume 20 μl
Amplification was conducted using a DNA thermal cycler programmed with 30
cycles included initial denaturation at 94° C for 10 min, denaturation at 94° C for
1min, annealing at 58°C for 1 min, extension at 72°C for 1 min and a final extension
at 72°C for 10 min as shown in table (3).The PCR products were analyzed in Agarose
gels and visualized under UV after staining with ethidium bromide.
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
403
Table (3): PCR Program for the detection of ddlE.faecium and ddl E.faecalis
genes by multiplex PCR
- Detection of EnterococcusEFaAgene:-
PCR were used to detect of EFaA gene in E.faecalis and E.faecium using specific
primers.
Reaction was conducted in 20 μl of reaction mixture containing 15μl of distilled water,
PCR master mix (Bioneer Corporation), 1μl forward and 1μl reverse primer ( the
sequence of primer is mentioned in table (4)), and 3 μl of DNA were added (table-5)
Table (4): The Sequence of Forward and Reverse Primers for EfaA gene used in
this study
Genes Sequence (5' to 3') Size Reference
EFaA F:GACAGACCCTCACGAATA
R:AGTTCATCATGCTGTAGTA
705 14
Table (5): The Mixture of PCR working solution for detection of
EnterococcusEFaA gene
Component Volume (μl)
Primer F. 1
Primer R. 1
DNA 3
water 15
Total Volume 20 μl
No. Steps Temperature (°C) Time
1. Initial Denaturation 94 10min
2. Denaturation 94 1min
3. Annealing 58 1min
4. Extension 72 1min
5. Final extension 72 10min
6. Cycles number 30
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
404
Amplification was conducted using a DNA thermal cycler programmed with 30
cycles included initial denaturation at 94° C for 5 min, denaturation at 94° C for 45
sec, annealing at 52°C at 1 min, extension at 72°C for 1 min and a final extension at
72°C for 3 min as shown in table (6).Products were analyzed in agarose gels and
visualized under UV after staining with ethidium bromide.
Table (6): PCR Program for the detection of EnterococcusEfaA gene by
conventional PCR
No. Steps Temperature (°C) Time
1 Initial Denaturation 94 5 min
2 Denaturation 94 45sec
3 Annealing 52 1 min
4 Extension 72 1 min
5 Final extension 72 3 min
6 Cycles number 30
-Biofilm production test:-
1- Congo Red Agar method
A specially prepared medium known as Congo Red Agar (CRA) was used for this
test. The Enterococcus strains were inoculated onto CRA and incubated at 37°C for
24 hours. Readings were taken after 24 hours and again after 48 hours. A positive
result was indicated by black colonies with black crystalline morphology. Nonbiofilm
producers mostly produced pink- or red-colored colonies (15).
2- Microtiter plate methods of biofilm assay
A modified microtiter plate method was used as previously described by (16). Briefly,
the wells of microtiter plate were filled with 200 μl of brain heart broth (BHB)
supplemented with .5% glucose. Then, a 20 μl quantity of previously prepared
bacterial suspensions with turbidity equal to 0.5 McFarland standards was added to
each well (3 well for each strain). The negative control wells contained 200 μl of
BHB and supplemented with 5% glucose. The plate was incubated at 37°C for 24 h
before removal of the cultures, then, the cells were decanted, and each well was
washed 3-times with sterile phosphate buffered saline dried in an inverted position
and stained with 1% crystal violet for 20 minutes. The wells were rinsed again with
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
405
distilled water and crystal violet was solubilized in 200 μl of ethanol. The OD at a
wavelength of 490 nm was determined using a micro ELISA auto reader (Bio-Rad).
These OD values were considered as an index of bacteria adhering to surface and
forming biofilms. Formation of biofilm by isolates was analyzed and categorized
relying on the absorbance of the crystal violet-stained attached cells table (7).
Table (7) Interpretation of biofilm production
OD value Biofilm production
ODc < ~ ≤ 2x ODc weak
2x ODc < ~ ≤ 4x ODc Moderate
> 4x ODc Strong
ODc = Optical density of negative control
RESULTS AND DISCUSSION
-Clinical Samples:-
Identification of Enterococcusby traditional methods:-
Fifty isolates were identified as Enterococcus on bile esculin agar (fig.1) depending
on creamy color of colony which convert the media to black, it consist of 40% bile
salt help in inhibition growth of Streptococci belong to group D antigen made this
media useful in diagnosis of Enterococcus from other non-Enterococcus bacteria that
belong to group D antigen (17)
Fig. (1): Appearance of Enterococcus isolates on bile esculin agar.
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
406
Finally, the API 20 strep system was used for accurate identification of the isolates at
generic and species level. The test gave positive results for all isolates as show in fig.
(2).
Fig. (2): Biochemical identification of Enterococcus using API 20 strep
-Identification of Enterococcus species by molecular methods:
Multiplex PCR technique were used for the diagnosis of all (50) isolates which has
grown on the selective media and has already been diagnosed based on their
morphology characteristic on culture media and biochemical test, using speciesspecific
primers for the D-alanine-D-alanine ligase gene (ddl E.faecalis and ddl
E.faecium) which was specific for diagnosis of E.faecalis and E.faecium.It give same
result of biochemical test (API 20 strep) 28bacteria isolates for E.faecalis and 22
bacteria isolates for E.faecium. Similar finding was reported by (18), piece that
amplify by PCR detect by using gel electrophoresis as show in fig. (3).
Fig. (3): Agarose gel electrophoresis of multiplex PCR for identification
ofEnterococcus species, M: marker (100pb ladder), lanes (1, 2, 3, 5, 7) positive
amplification of ddl E.faecium gene (658) Pb, lanes (4, 6, 8, 9) positive amplification
of ddl E.faecalis gene (941) Pb.
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
407
-Detection of EfaA gene in E.faecalis and E.faecium by conventional PCR:-
Several virulence and pathogenic factors have been described from Enterococci that
enhance their ability to colonize patient's tissues, increase resistance to antibiotics,
and aggravate the infection outcomes (19).Conventional PCR was performed for
E.faecalis and E.faecium in order to confirm the presence of E.faecalis endocarditis
antigen (EfaA) by use specific primers. Piece of DNA that amplified by PCR were
detect by using gel electrophoresis as show in fig. (4).
Fig. (4) Agarose gel electrophoresis of conventional PCR amplification products of
EnterococcusEfaA gene (705pb).M: marker (100 bp ladder) lanes (1-5): positive
amplification of EfaA gene in E.faecalis, lanes (6-9): positive amplification of EfaA
gene in E.faecium.
Our results showed the presenceEfaA gene 100% in E.faecalis. The results presented
here go along nicely with the results recorded by (20) who found that E.faecalisEFaA
gene presence 100% in urine samples.
The percentage of EfaA gene in E.faecium was 100% theseresults were matched with
study of (21) who found that EfaA presence in 100% in E.faecium.The high incidence
of virulence factors (EfaA) in urinary strains could potentially contribute to facilitate
bacterial colonization and pathogenesis of Enterococcus in the urinary tract.
-Detection of biofilm production:-
Biofilm producing bacteria are responsible for many recalcitrant infections and are
difficult to eradicate (22). Enterococci are one of the causative organisms of
UTI.Biofilm formation allows the strain to persist in genitourinary tract for long time,
and survival advantages conferred by biofilm include resistance to phagocytosis and
antimicrobial agents .There are various methods to detect biofilm production;in this
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
408
study we evaluated 50 isolates by two screening methods for their ability to form
biofilms, Congo red agar method [CRA] and microtitre plate method [MTP] (23).
In CRA methods all bacterial isolates were grown in Cong red agar to detect biofilm
production as shown in fig. (5).
Fig. (5) Detection of Enterococcus biofilm production on Congo red agar Method
Our results showedthat 26(92.8%) isolates of E.faecalis were biofilmproducer(strong
and moderate) and 2(7.1%)were weakbiofilmproduction, while 21(95%) isolates of
E.faeciumwere biofilm (strong and moderate) production and1 (4.5%) weak biofilm
production as show in table (8).
Table (8): percentage of E.faecalis and E.faecium biofilm production on CRA
medium
Number of Strong Moderate weak
isolates
Enterococcus
species
E.faecalis 28 12(42.8%) 14(50%) 2(7.1%)
E.facium 22 10(45.4%) 11(50%) 1(4.5%)
Total 50 22(44%) 25(50%) 3(6%)
Such a high percentage of biofilm production in our results agree partially with a
study obtainedby (24) who find that (85.7%) of E.faecalis isolates were slimes
producer on CRA plates.In addition these results agree with study done by (25) who
found that the ability to produce biofilm was detected in 90% ofE.faecium isolates.In
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
409
MTP methods we used polystyrene plate of 96 wells for detection of biofilm
production as shown in fig. (6).
Fig. (6): polystyrene plate for detection biofilm in Enterococcus
Our results showed that 11(39%) isolates of E.faecalis detected as strong biofilm
production, 14(50%) isolates as intermediate and 3(10%) as weak biofilm production,
close to these results were reported by(11) who found 39% of isolates strong, , 52%
moderate and 9% of isolates weak biofilm production.
The percentage of biofilm formation in E.faecium was 9(40%) as strong, 12(54.5%)
moderate and 1(4.5%) as weak biofilm production as shown in table (9).
Table (9): percentage of E.faecalis and E.faecium biofilm production by (MTP)
method
Number of strong Moderate weak
isolates
Enterococcus
species
E.faecalis 28 11(39%) 14(50%) 3(10%)
E.facium 22 9(40.9%) 12(54.5%) 1(4.5%)
Total 50 20(40%) 26(52%) 4(8%)
These results partially agree with (26) who found that 9(32.14%) fecal isolates of
E.faecium were strong biofilm production, 3(10.7%) weak biofilm production.
On the other hand,these results weredisagreeing with study of (27) who found that
E.faecalis 39 (25.16%) and E.faecium 42 (27.09%) produce biofilm.
Microtitre plate method were found to be most sensitive, accurate and reliable
screening method for detection of biofilm formation when compared to CRA
methods.Microtiter plate method was quantitative test and it was considered the gold
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
410
standard method for biofilm detection (28). Many studies have statistically evaluated
the sensitivity and specificity between the two methods. Most of the studies
recommend MTP method for general screening on biofilm formation (29) also found
MTP method to be more suitable for biofilm detection as compared to CRA method.
Similarly, (30) and (31) found MTP method to be superior to MTP and CRA methods.
-Comparison of the prevalence of EfaA genes among biofilm positive and biofilm
negative in E.faecium and E.faecalis isolates:-
EfaA have a significant role in Enterococcus adhesion to biotic and abiotic
surface which is the first step in biofilm production (9).
Our results show that E.faecalis have 25(89.2%)of EfaA gene in biofilm positive
isolates and 3(10.7%) in biofilm negative isolates, while,the results of the presence of
EfaA gene in E.faeciumwere 21(95.4%) in biofilm positive isolates and 1(4.5%) in
biofilm negative isolates as shown in fig. (7). Our results demonstrate that the
prevalence of EfaA gene in biofilm positive Enterococcus isolates were higher than in
biofilm negative isolates.
Fig. (7): percentage of EfaA gene among biofilm positive and negative E.faecalis
and E.faecium isolates
These results were agreedwith (32) who showed that isolates with the EfaA gene
produced more biofilms than negative ones. These results indicate the role of EfaA
gene in biofilm production.
Enterococcus و Enterococcos fecalis فی بکتریا EfaA التشخیص الجزیئی لموروث
ودوره فی تکوین الغشاء الحیوی facium
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
411
اشواق باسم الھاشمی ، ایھ الحلبی
معھد الھندسھ الوراثیھ للدراسات العلیا،جامعة بغداد ،بغداد ،العراق
الخلاصة
تم جمع ( 104 ) عینة ادرار من المرضى المصابین بالتھاب المجاری البولیة لمختلف الفئات العمریة من
مستشفیات مختلفة فی بغداد (مستشفى ابن البلدی ،الیرموک،مدینة الطب،الکندی ومستشفى بغداد) وللفترة من
بدایة ایلول 2015 ولغایة نھایة کانون الاول 2015 .فحصت جمیع العینات باستخدام الطرائق التقلیدیة
اظھرت نتائج التشخیص ، API 20 strep بلاعتماد على الصفات الزرعیة والاختبارات الکیموحیویة ونظام
بالاعتماد على الطرائق التقلیدیة عائدیة 50 عزلة لبکتریا المکورات المعویة وھذا مااکدتھ ایضا نتائج تفاعل
السلسلة المتبلمرة اعتمادا على مورثات متخصصة.اجری تفاعل السلسة المتبلمرة ایضا للتحری عن وجود
المشفرالى مستضد التھاب شغاف القلب لبکتریا المکورات المعویة البرازیة باستخدام بوادىء EFaA موروث
تم الکشف .EFaA متخصصة ،اظھرت النتائج احتواء بکتریا المکورات المعویة على نسبة 100 % من موروث
microtitre وطریقة Congo red agar : باستخدام طریقتین E.faecium و E.faecalis عن إنتاج بیوفیلم فی
(%50) 44 %)من عزلات بکتریا المکورات المعویة منتجة قویة للبایوفلم، 25 ) اظھرت النتائج ان 22 ،plate
ان MTP اظھرت نتائج باستخدام طریقة ،CRA 6%)ضعیف بانتاجة للبایوفلم باستخدام طریقة ) متوسط و 3
8%) ضعیف بانتاجة للبایوفلم.تھدف ھذه ) 52 %) متوسط و 4 ) %40 )من العزلات البکتیریة منتجة قوی ، 26 )20
من مرضى التھاب المجاری البولیة باستخدام E.faecium وE.faecalis الدراسة الى تشخیص کل من بکتریا
وعلاقتة بانتاج البایوفلم. EfaA طرائق تقلیدیة وجزیئیة وکذلک الکشف عن موروث
REFERENCE
1- Tendolkar, P. M.; Baghdayan, A. S., and Shankar, N. (2006). Putative surface
proteins encoded within a novel transferable locus confer a high-biofilm phenotype to
Enterococcusfaecalis. Journal of bacteriology, 188(6): 2063-2072.
2- Mohamed, J. A., and Huang, D. B. (2007). Biofilm formation by Enterococci.
Journal of medical microbiology, 56(12): 1581-1588.
3- Biel, M. A. (2010). Photodynamic therapy of bacterial and fungal biofilm
infections. Photodynamic Therapy: Methods and Protocols: 175-194.
4- Hammerum, A. M. (2012). Enterococci of animal origin and their significance for
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
412
public health. Clinical Microbiology and Infection, 18(7): 619-625.
5-Van Tyne, D.,and Gilmore, M. S. (2014). Friend turned foe: evolution of
Enterococcal virulence and antibiotic resistance. Annual review of microbiology, 68,
337.
6- Kristich, C. J.; Li, Y. H.; Cvitkovitch, D. G., and Dunny, G. M. (2004). Espindependent
biofilm formation by Enterococcus faecalis. Journal of
bacteriology, 186(1): 154-163.
7- Extremina, C. I.; Costa, L.; Aguiar, A. I.; Peixe, L., and Fonseca, A. P. (2011).
Optimization of processing conditions for the quantification of Enterococci biofilms
using microtitre-plates. Journal of microbiological methods, 84(2): 167-173.
8- Fisher, K., and Phillips, C. (2009). The ecology, epidemiology and virulence of
Enterococcus. Microbiology, 155(6): 1749-1757.
9- Pérez-Pulido, R.; Abriouel, H.; Omar, N. B.; Lucas, R.; Martinez-Canamero, M.,
and Galvez, A. (2006). Safety and potential risks of Enterococci isolated from
traditional fermented capers. Food and chemical toxicology, 44(12): 2070-2077.
10-Kafil, H. S., and Mobarez, A. M. (2015). Assessment of biofilm formation by
Enterococci isolates from urinary tract infections with different virulence
profiles. Journal of King Saud University-Science, 27(4): 312-317.
11-Mohamed, J. A.; Huang, W.; Nallapareddy, S. R.; Teng, F., and Murray, B. E.
(2004). Influence of origin of isolates, especially endocarditis isolates, and various
genes on biofilm formation by Enterococcus faecalis. Infection and immunity, 72(6):
3658-3663.
12- Preethee, T.; Kandaswamy, D., and Hannah, R. (2012). Molecular identification
of an Enterococcus faecalis endocarditis antigen efaA in root canals of therapyBasrah
Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
413
resistant endodontic infections. Journal of conservative dentistry, 15(4), 319.
13- Sharifi, Y.; Hasani, A.; Ghotaslou, R.; Varshochi, M.; Hasani, A.; Aghazadeh,
M., and Milani, M. (2012). Survey of virulence determinants among vancomycin
resistant Enterococcus faecalis and Enterococcus faecium isolated from clinical
specimens of hospitalized patients of North west of Iran. The open microbiology
journal, 6(1).
14- Eaton, T. J., and Gasson, M. J. (2001). Molecular screening of Enterococcus
virulence determinants and potential for genetic exchange between food and medical
isolates. Applied and environmental microbiology, 67(4): 1628-1635.
15- Freeman, D. J.; Falkiner, F. R., and Keane, C. T. (1989). New method for
detecting slime production by coagulase negative staphylococci. Journal of clinical
pathology, 42(8): 872-874.
16- Mirzaee, M.; Najar Peerayeh, S., and Ghasemian, A. M. (2014). Detection of
icaABCD genes and biofilm formation in clinical isolates of methicillin resistant
Staphylococcusaureus. Iranian Journal of Pathology, 9(4): 257-262.
17-MacFaddin, J.F. 2000. Biochemical tests for identification of medical bacteria, 3rd
ed. Lippincott Williams and Wilkins, Baltimore.
18- Comerlato, C. B.; Resende, M. C. C. D.; Caierão, J., and d'Azevedo, P. A. (2013).
Presence of virulence factors in Enterococcus faecalis and Enterococcus faecium
susceptible and resistant to vancomycin. Memórias do Instituto Oswaldo
Cruz, 108(5): 590-595.
19- Dupont, H., Vael, C., Muller-Serieys, C., Chosidow, D., Mantz, J., Marmuse, J.
P., ... & Desmonts, J. M. (2008). Prospective evaluation of virulence factors of
Enterococci isolated from patients with peritonitis: impact on outcome. Diagnostic
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
414
microbiology and infectious disease, 60(3): 247-253.
20- Cosentino, S.; Podda, G. S.; Corda, A.; Fadda, M. E.; Deplano, M., and Pisano,
M. B. (2010). Molecular detection of virulence factors and antibiotic resistance
pattern in clinical Enterococcus faecalis strains in Sardinia.Journal of preventive
medicine and hygiene, 51(1).
21- Soheili, S.; Ghafourian, S.;Sekawi, Z.;Neela, V.;Sadeghifard, N.;Ramli, R., and
Hamat, R. A. (2014). Wide distribution of virulence genes among Enterococcus
faecium and Enterococcus faecalis clinical isolates. The Scientific World
Journal, 2014.
22-Lewis, K. (2001). Riddle of biofilm resistance. Antimicrobial agents and
chemotherapy, 45(4): 999-1007.
23- Akhter, J.; Anwar, S., and Ahmed, S. (2012). Enterococcal Virulence
Determinants In Urinary Tract Infection Patients. Bangladesh Journal of Medical
Microbiology, 6(1): 14-17.
24- Mohamad, E. A., and El Shalakan, A. H. (2016). Detection of Biofilm Formation
in Uropathogenic Bacteria. The Egyptian Journal of Medical Microbiology
(EJMM), 24(1).
25- Sieńko, A.; Wieczorek, P.; Majewski, P.; Ojdana, D.; Wieczorek, A.; Olszańska,
D., and Tryniszewska, E. (2015). Comparison of antibiotic resistance and virulence
between biofilm-producing and non-producing clinical isolates of Enterococcus
faecium. ActaBiochimicaPolonica, 62(4): 859-866.
26- Diani, M.;Esiyok, O. G.;Ariafar, M. N.;Yuksel, F. N.;Altuntas, E. G., andAkcelik,
N. (2014). The interactions between esp, fsr, gelE genes and biofilm formation and
pfge analysis of clinical Enterococcus faecium strains. African Journal of
Basrah Journal of Veterinary Research,Vol.15, No.3,2016
Proceeding of 5th International Scientific Conference,College of Veterinary Medicine
University of Basrah,Iraq
415
Microbiology Research, 8(2): 129-137.
27- Banerjee, T., and Anupurba, S. (2015). Prevalence of virulence factors and drug
resistance in clinical isolates of Enterococci: A study from North India.Journal of
pathogens, 2015.
28- Mathur, T.;Singhal, S.; Khan, S.; Upadhyay, D. J.; Fatma, T., and Rattan, A.
(2006). Detection of biofilm formation among the clinical isolates of staphylococci:
an evaluation of three different screening methods. Indian journal of medical
microbiology, 24(1), 25.
29- Knobloch, J. K. M.;Horstkotte, M. A.; Rohde, H., and Mack, D. (2002).
Evaluation of different detection methods of biofilm formation in Staphylococcus
aureus. Medical microbiology and immunology, 191(2): 101-106.
30- Hittinahalli, V.;Karjigi, S. K., and Reddy, K. M. (2012). Escherichia coli,
Biofilm, Drug Resistance, Congo Red Agar, Tissue Culture Plate. Correlation
between Biofilm formation of UropathogenicEscherichai Coli and its Antibiotic
resistance pattern., (68).
31-Ira, P.; Sujatha, S., and Chandra, P. S. (2013). Virulence factors in clinical and
commensal isolates of Enterococcus species. Indian Journal of Pathology and
Microbiology, 56(1), 24.
32-Kafil, H. S., &Mobarez, A. M. (2015). Assessment of biofilm formation by
enterococci isolates from urinary tract infections with different virulence profiles.
Journal of King Saud University-Science, 27(4), 312-317.